ID: 1070295134

View in Genome Browser
Species Human (GRCh38)
Location 10:75154101-75154123
Sequence AGTAAGCCCACAGGATGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070295129_1070295134 24 Left 1070295129 10:75154054-75154076 CCATGCCCGGTGAGCTGTAGTAA No data
Right 1070295134 10:75154101-75154123 AGTAAGCCCACAGGATGGAGTGG No data
1070295130_1070295134 19 Left 1070295130 10:75154059-75154081 CCCGGTGAGCTGTAGTAAAGAGT No data
Right 1070295134 10:75154101-75154123 AGTAAGCCCACAGGATGGAGTGG No data
1070295128_1070295134 27 Left 1070295128 10:75154051-75154073 CCACCATGCCCGGTGAGCTGTAG No data
Right 1070295134 10:75154101-75154123 AGTAAGCCCACAGGATGGAGTGG No data
1070295131_1070295134 18 Left 1070295131 10:75154060-75154082 CCGGTGAGCTGTAGTAAAGAGTT No data
Right 1070295134 10:75154101-75154123 AGTAAGCCCACAGGATGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070295134 Original CRISPR AGTAAGCCCACAGGATGGAG TGG Intronic