ID: 1070302024

View in Genome Browser
Species Human (GRCh38)
Location 10:75210679-75210701
Sequence CACGTGGACCGACAGCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070302024_1070302029 -3 Left 1070302024 10:75210679-75210701 CCGGGGCGCTGTCGGTCCACGTG 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1070302029 10:75210699-75210721 GTGGCCGCTCTGGAGCAGGTTGG 0: 1
1: 0
2: 0
3: 17
4: 201
1070302024_1070302031 3 Left 1070302024 10:75210679-75210701 CCGGGGCGCTGTCGGTCCACGTG 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1070302031 10:75210705-75210727 GCTCTGGAGCAGGTTGGAGTTGG 0: 1
1: 0
2: 1
3: 22
4: 297
1070302024_1070302033 10 Left 1070302024 10:75210679-75210701 CCGGGGCGCTGTCGGTCCACGTG 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1070302033 10:75210712-75210734 AGCAGGTTGGAGTTGGCAGCGGG 0: 1
1: 0
2: 2
3: 25
4: 322
1070302024_1070302035 23 Left 1070302024 10:75210679-75210701 CCGGGGCGCTGTCGGTCCACGTG 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1070302035 10:75210725-75210747 TGGCAGCGGGCTGCGCTGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 162
1070302024_1070302032 9 Left 1070302024 10:75210679-75210701 CCGGGGCGCTGTCGGTCCACGTG 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1070302032 10:75210711-75210733 GAGCAGGTTGGAGTTGGCAGCGG 0: 1
1: 0
2: 2
3: 40
4: 414
1070302024_1070302036 28 Left 1070302024 10:75210679-75210701 CCGGGGCGCTGTCGGTCCACGTG 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1070302036 10:75210730-75210752 GCGGGCTGCGCTGCAGGGACAGG 0: 1
1: 0
2: 4
3: 19
4: 263
1070302024_1070302034 22 Left 1070302024 10:75210679-75210701 CCGGGGCGCTGTCGGTCCACGTG 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1070302034 10:75210724-75210746 TTGGCAGCGGGCTGCGCTGCAGG 0: 1
1: 0
2: 2
3: 10
4: 209
1070302024_1070302028 -7 Left 1070302024 10:75210679-75210701 CCGGGGCGCTGTCGGTCCACGTG 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1070302028 10:75210695-75210717 CCACGTGGCCGCTCTGGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070302024 Original CRISPR CACGTGGACCGACAGCGCCC CGG (reversed) Intronic
900494862 1:2971799-2971821 CACCTGAACCGCCAGGGCCCAGG - Intergenic
906045881 1:42830669-42830691 CCCGGGGACGGACAGAGCCCAGG - Intronic
919112089 1:193233286-193233308 CAGGAGGACTGACAGAGCCCAGG - Intronic
1065930272 10:30472926-30472948 CAGCTGGACTGACAGCCCCCAGG - Intergenic
1070302024 10:75210679-75210701 CACGTGGACCGACAGCGCCCCGG - Intronic
1075054008 10:119204983-119205005 CACGAGGATCGACAGAGCCCTGG + Intergenic
1075940445 10:126387153-126387175 TCGGTGGACCGACAGCGCCCCGG + Intronic
1077546576 11:3173181-3173203 CACGTGGACAGACAGCTTCTGGG + Intergenic
1083033430 11:59615270-59615292 CAAGGTGAGCGACAGCGCCCCGG + Intronic
1083564345 11:63700509-63700531 CAGGTGGACCGCTTGCGCCCAGG - Intronic
1084156914 11:67318203-67318225 CCCGTGGGCTGCCAGCGCCCGGG - Intronic
1084446430 11:69206172-69206194 CACGTGGCCCCTCAGTGCCCGGG + Intergenic
1084960312 11:72712995-72713017 CACGTGTAGCCACAGCGCTCTGG - Intronic
1107841068 13:44458749-44458771 CACCTGGTCGGACAGCGCCCAGG - Intronic
1115427123 14:33273052-33273074 CACATGGACCGTCAGGGACCAGG - Intronic
1122926705 14:104906497-104906519 CACCTGCAGCGACAGCTCCCTGG - Intergenic
1122926767 14:104906760-104906782 CACCTGCAGCGACAGCTCCCTGG - Intergenic
1128181855 15:65611524-65611546 CTCGTGCACCGACGGGGCCCAGG - Intronic
1132025774 15:98403404-98403426 CACGTGGCCCCACAGAGCCCAGG + Intergenic
1132336876 15:101053448-101053470 CCCGGAGACCGACAGAGCCCCGG + Intronic
1138223132 16:55270008-55270030 CACGTGGAGGAACAGAGCCCAGG + Intergenic
1143259155 17:5585210-5585232 CACTTGGACTGGCAGAGCCCAGG + Intronic
1144726831 17:17506418-17506440 CACTTGGGCCGACCGAGCCCAGG + Intronic
1148572153 17:48678624-48678646 CAGGTGAACAGACAGCGGCCGGG + Intergenic
1152048955 17:77958276-77958298 AACGCGGAGCCACAGCGCCCAGG + Intergenic
1153660011 18:7317856-7317878 CACGTGTACAGAAAGCACCCAGG - Intergenic
1153995737 18:10440080-10440102 CACGTGGGCCTGCAGAGCCCAGG + Intergenic
1155071960 18:22324805-22324827 CACGTGGACAGAGGGCCCCCGGG + Intergenic
1155474827 18:26227016-26227038 CACCCGCACCGGCAGCGCCCCGG - Exonic
1156338253 18:36188081-36188103 TGCGTGGACCGCCAGCGCCCGGG + Intronic
1160838166 19:1134205-1134227 CAGGTGGACCCACAGCTCACAGG + Intronic
1160838176 19:1134263-1134285 CACCTGGACCCACAGCTCACGGG + Intronic
1160838187 19:1134317-1134339 CGGGTGGACCCACAGCTCCCGGG + Intronic
1162301224 19:9846264-9846286 CACGTGGGCCGGCAGGGCCAAGG + Intronic
1162535799 19:11262340-11262362 CACGTGGCCCGGCTCCGCCCCGG - Intronic
1165354112 19:35293307-35293329 CACCTGGACAGACACAGCCCTGG - Intronic
927720782 2:25380736-25380758 CACGTGCAGAGACAGTGCCCTGG + Intronic
946057635 2:216915925-216915947 CACTTGGGCCGACAACTCCCGGG - Intergenic
948279488 2:236735870-236735892 CACGTGGCCCCACAGTGACCAGG - Intergenic
948513504 2:238488562-238488584 CACGTGGGCCAAGGGCGCCCAGG - Intergenic
948874606 2:240820018-240820040 CACCTGCACCCACTGCGCCCAGG - Intronic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1174065187 20:47859724-47859746 CACGTGGAGCCACAGCACACTGG - Intergenic
1174445057 20:50585395-50585417 CATGTGGACCCACAGGGGCCTGG + Intergenic
1175423541 20:58850788-58850810 CACGAGGACCGCTAGCGCCGTGG - Intronic
1175962007 20:62642150-62642172 CACTCGGCCCCACAGCGCCCAGG + Exonic
1176131452 20:63498435-63498457 CACAGGGACAGACAGCGGCCGGG + Intronic
1180614729 22:17120042-17120064 CAGGGGCACCGACAGCGCCATGG + Exonic
1182704795 22:32270408-32270430 CATGTGGACAGTCATCGCCCTGG + Intergenic
1184049922 22:41996913-41996935 CAGGTGGAAGGACAGTGCCCAGG - Exonic
968705678 4:2076311-2076333 CATGTGGAGCCGCAGCGCCCTGG - Intronic
976246881 4:83013087-83013109 CACGTGGAACTGGAGCGCCCTGG - Intergenic
977857661 4:101913492-101913514 CACATGGACCGCAAGCTCCCAGG + Intronic
981544782 4:145882806-145882828 CAGGTGCACGGACAGAGCCCAGG + Intronic
1009396972 6:63211494-63211516 GGCGTGGACCGACAGCGACCTGG - Exonic
1045653442 8:104364076-104364098 CACGCTGGCCGAGAGCGCCCAGG + Intronic
1049349979 8:142159247-142159269 CAGGTGGACCCACATCTCCCAGG + Intergenic
1049774668 8:144398793-144398815 CATGTGGACAGTCATCGCCCCGG - Exonic
1192579665 X:72270607-72270629 CAGGTGGATCGACTGAGCCCAGG - Intronic
1200049567 X:153421645-153421667 CACGCAGACCGGCCGCGCCCTGG - Intergenic
1201150739 Y:11094338-11094360 CACGTGGACACCCAGCCCCCAGG + Intergenic