ID: 1070304663

View in Genome Browser
Species Human (GRCh38)
Location 10:75233264-75233286
Sequence GGGGAGGTGGAGAAGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070304663_1070304674 26 Left 1070304663 10:75233264-75233286 CCTGGTTCCTTCTCCACCTCCCC No data
Right 1070304674 10:75233313-75233335 TGAAGTTCTCTTCATCCTCTAGG No data
1070304663_1070304671 -3 Left 1070304663 10:75233264-75233286 CCTGGTTCCTTCTCCACCTCCCC No data
Right 1070304671 10:75233284-75233306 CCCTCATAGGCAGATGGTTCAGG No data
1070304663_1070304675 27 Left 1070304663 10:75233264-75233286 CCTGGTTCCTTCTCCACCTCCCC No data
Right 1070304675 10:75233314-75233336 GAAGTTCTCTTCATCCTCTAGGG No data
1070304663_1070304667 -9 Left 1070304663 10:75233264-75233286 CCTGGTTCCTTCTCCACCTCCCC No data
Right 1070304667 10:75233278-75233300 CACCTCCCCTCATAGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070304663 Original CRISPR GGGGAGGTGGAGAAGGAACC AGG (reversed) Intergenic
No off target data available for this crispr