ID: 1070305179

View in Genome Browser
Species Human (GRCh38)
Location 10:75235300-75235322
Sequence GCGCCAGGTTGGCCAAGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070305166_1070305179 17 Left 1070305166 10:75235260-75235282 CCCCTACCCAGGTCCAGCGCCTT 0: 1
1: 0
2: 2
3: 6
4: 148
Right 1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1070305173_1070305179 4 Left 1070305173 10:75235273-75235295 CCAGCGCCTTCTTGGCCTGGATG 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1070305167_1070305179 16 Left 1070305167 10:75235261-75235283 CCCTACCCAGGTCCAGCGCCTTC 0: 1
1: 0
2: 2
3: 21
4: 198
Right 1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1070305162_1070305179 29 Left 1070305162 10:75235248-75235270 CCCGGCCGCGTGCCCCTACCCAG 0: 1
1: 0
2: 3
3: 15
4: 211
Right 1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1070305168_1070305179 15 Left 1070305168 10:75235262-75235284 CCTACCCAGGTCCAGCGCCTTCT 0: 1
1: 0
2: 2
3: 14
4: 208
Right 1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1070305165_1070305179 24 Left 1070305165 10:75235253-75235275 CCGCGTGCCCCTACCCAGGTCCA 0: 1
1: 0
2: 1
3: 18
4: 244
Right 1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1070305174_1070305179 -2 Left 1070305174 10:75235279-75235301 CCTTCTTGGCCTGGATGAGCCGC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1070305163_1070305179 28 Left 1070305163 10:75235249-75235271 CCGGCCGCGTGCCCCTACCCAGG 0: 1
1: 0
2: 0
3: 29
4: 205
Right 1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1070305171_1070305179 10 Left 1070305171 10:75235267-75235289 CCAGGTCCAGCGCCTTCTTGGCC 0: 1
1: 0
2: 2
3: 21
4: 240
Right 1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1070305170_1070305179 11 Left 1070305170 10:75235266-75235288 CCCAGGTCCAGCGCCTTCTTGGC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070305179 Original CRISPR GCGCCAGGTTGGCCAAGAGC TGG Exonic
900001616 1:17749-17771 GGGCCAGGATGGCCAAGGGATGG + Intergenic
900021337 1:188273-188295 GGGCCAGGATGGCCAAGGGATGG + Intergenic
900468312 1:2836711-2836733 CCGCCAGGAGGGCCCAGAGCAGG + Intergenic
900512552 1:3067531-3067553 GAGCCGGGTTGGGCAGGAGCTGG - Intergenic
901212397 1:7534045-7534067 GAGCCAGGCTGGGCAAGGGCAGG - Intronic
901641651 1:10695647-10695669 GCGCCTGGCTGGCCATGGGCTGG - Intronic
903008529 1:20314407-20314429 TCCCCAGGTTGGCCACGAACAGG - Exonic
915059460 1:153169022-153169044 GGGCCCCCTTGGCCAAGAGCGGG - Intergenic
916081100 1:161232898-161232920 GGGCCAGGGTGGGCAAGGGCTGG + Exonic
920650249 1:207832213-207832235 GTGCCAGCTTTGCCAGGAGCAGG + Intergenic
922485901 1:225972780-225972802 ACGCCAGCTTGGACCAGAGCAGG + Intergenic
923885175 1:238146527-238146549 GAGCTCCGTTGGCCAAGAGCAGG + Intergenic
1063666124 10:8061816-8061838 GCACCAGGGTGCCCAGGAGCCGG + Intronic
1067850622 10:49751646-49751668 TAGGCAGTTTGGCCAAGAGCTGG - Intronic
1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG + Exonic
1073069308 10:100783126-100783148 GCGCCTGGCTGGCCCAGAACAGG + Intronic
1073189027 10:101637013-101637035 GAGCAAGGTTAGCCAAGAGTTGG + Intronic
1075604432 10:123794083-123794105 CCTCCAAGTCGGCCAAGAGCAGG - Intronic
1076053160 10:127351290-127351312 GAGCCAGGATGGCCTAGAGCTGG - Intronic
1076536588 10:131181687-131181709 GGGCCAGGTGGGCCAGGAGCAGG + Intronic
1077094179 11:792409-792431 GGTTCAGGTTGGCAAAGAGCGGG + Exonic
1077180141 11:1208581-1208603 GGGCCAGGTGGGGCAGGAGCCGG + Intergenic
1077230702 11:1457105-1457127 GAGCCAGGCTGGCCCTGAGCAGG + Intronic
1079638779 11:22778556-22778578 GAGCCAGGCTTGCGAAGAGCGGG + Intronic
1081614321 11:44581633-44581655 ACTCCAGGTTGGCCCGGAGCTGG - Intronic
1081863225 11:46346029-46346051 GTGCCAGGGTGGCCAGGAGGAGG - Intronic
1083655407 11:64226838-64226860 GCGCCAGGGTGGCTGAGTGCAGG - Exonic
1083894461 11:65613240-65613262 GTGCCAGCATGGCGAAGAGCCGG + Exonic
1084272896 11:68038581-68038603 TCTCCAGGGTGGTCAAGAGCAGG + Intergenic
1084331272 11:68432047-68432069 GAGCCAGGCTGGGCAAGAGGCGG + Intronic
1089214103 11:116825349-116825371 GCGCCAGGTGGGCCAGAGGCAGG + Intergenic
1089312758 11:117570917-117570939 GGGCCAGGCTGGCAGAGAGCTGG - Intronic
1091346417 11:134857196-134857218 TGGCCAGGTTGGCCTTGAGCAGG - Intergenic
1091374702 12:17866-17888 GGGCCAGGATGGCCAAGGGATGG + Intergenic
1092296360 12:7202255-7202277 GCGGCAGATTGGCGAAGGGCAGG + Exonic
1096216548 12:49800995-49801017 TCGCCAGGTTGGCACAGAGCTGG - Intronic
1097003762 12:55900516-55900538 GTGCCATGTAGGCCGAGAGCAGG - Intergenic
1097884984 12:64720045-64720067 GCGACAGGTTGGCCCAGAACAGG + Exonic
1103568098 12:121827142-121827164 GGCCCAGGGAGGCCAAGAGCAGG + Intronic
1106346923 13:28888000-28888022 GCGACTGGATGGCCAACAGCAGG - Intronic
1107003342 13:35577309-35577331 GCACCAGGTAGACCAAGAGTGGG + Intronic
1108746545 13:53401044-53401066 GTTCCAGGCTGGCCCAGAGCAGG - Intergenic
1113417275 13:110138218-110138240 GCGCCCGGTTGCCCACGAGGCGG + Intergenic
1119351963 14:73973248-73973270 GCACAAGGTTGGCCATGATCTGG - Intronic
1119830314 14:77696478-77696500 GCCCCAGGTAGGACAAGACCAGG - Intronic
1126343617 15:47670130-47670152 GCGCCAGGGTGGCCAAGAGGAGG - Intronic
1130635657 15:85617440-85617462 TCGCCATGTTGGCCACGATCTGG + Intronic
1131179050 15:90227962-90227984 TCGCCAGGTTGGAGAGGAGCGGG - Exonic
1132455001 16:17434-17456 GGGCCAGGATGGCCAAGGGATGG + Intronic
1132929068 16:2449431-2449453 GCGTCAGTCTGGCCAGGAGCAGG - Exonic
1132986933 16:2772138-2772160 GCCCCAGCTGGGGCAAGAGCTGG - Intronic
1133724537 16:8525310-8525332 GAGCCAGGTTGACTAAGGGCAGG + Intergenic
1138538539 16:57673768-57673790 GTGCCAGGTTAGCCCAGAGGAGG + Intronic
1141235393 16:82211235-82211257 AGACCAGGTTGGCCAAGAGTTGG + Intergenic
1141266520 16:82502727-82502749 GGGCCTGGTGGGCCAAGAGCAGG + Intergenic
1141664819 16:85460611-85460633 GCTCCAAGCTGGGCAAGAGCCGG + Intergenic
1144864818 17:18328718-18328740 GCGCCAGGTGGGTCCAGAGTGGG + Exonic
1146941542 17:36847178-36847200 GCGCCTGGAGGACCAAGAGCAGG + Intergenic
1149784372 17:59422907-59422929 ACCCCAGGTTGGCCTAGAACTGG + Intergenic
1151669757 17:75565534-75565556 GGGCCATGTTGGCACAGAGCGGG + Intronic
1151718976 17:75845026-75845048 GGGCCAGGCTGGCCAGGAGGAGG + Intergenic
1152568675 17:81111725-81111747 GTGCCAGGGTGTCCAGGAGCAGG + Intronic
1152575321 17:81137450-81137472 GTGCCAGGGTGGCCGAGAGCAGG - Intronic
1153713699 18:7824377-7824399 GCACCAGGCAGCCCAAGAGCAGG + Intronic
1155303535 18:24456096-24456118 GCCCCAGCTTGGCAAAGTGCAGG + Intergenic
1159992126 18:74921195-74921217 GCCCTAGGTTGGGGAAGAGCTGG + Intronic
1160655675 19:267519-267541 GCTCCAGGTTGGGCGGGAGCCGG + Intergenic
1160946337 19:1645628-1645650 GGGCCAGGTTGCCCCAAAGCGGG - Intronic
1162630953 19:11926349-11926371 GGGTCCTGTTGGCCAAGAGCCGG + Intronic
1166699835 19:44875892-44875914 GCGCCAGGCGAGCCCAGAGCGGG - Intronic
1167145674 19:47679920-47679942 GCACCTGCTTGGCCAGGAGCTGG - Exonic
926089747 2:10042617-10042639 GCGCCAGGTTCGTGGAGAGCAGG - Intergenic
929603622 2:43220166-43220188 ACGCCAGGGTGGCCATGTGCAGG - Intergenic
930866067 2:56123226-56123248 GCGGCAACTTGGCCAAGAGCTGG - Intergenic
931263261 2:60638455-60638477 GCTCTGGGTTGGCCAAGAGGAGG - Intergenic
931773181 2:65517139-65517161 GAGCCATGTAGGCCAAGAGTGGG + Intergenic
932073982 2:68646115-68646137 TGGCCAGGTTGGCGATGAGCAGG - Exonic
933746376 2:85574721-85574743 TCTCCATGTTGGTCAAGAGCTGG + Intronic
936568107 2:113595664-113595686 GGGCCAGGATGGCCAAGGGATGG - Intergenic
936893967 2:117405828-117405850 TCACCATGTTGGCCAAGCGCTGG - Intergenic
937969954 2:127541846-127541868 GCACCAGGCTCTCCAAGAGCAGG + Intronic
946075943 2:217073632-217073654 GTCCCTGGTAGGCCAAGAGCTGG + Intergenic
1169349432 20:4856272-4856294 GGGCCAGGGTGGCCAAGAGAAGG + Exonic
1172504748 20:35453368-35453390 GTACCAGCTAGGCCAAGAGCTGG + Intronic
1173911928 20:46676871-46676893 ACGCCAGGGTGGCCAGGAGGGGG + Intronic
1174684565 20:52441284-52441306 CAGCCAGGTAGGCAAAGAGCTGG + Intergenic
1175201262 20:57279516-57279538 GCGCAAGGTAAGCCAAGACCTGG - Intergenic
1175919006 20:62441319-62441341 ACGCCATGTTGGCCAAGGTCGGG + Intergenic
1176194310 20:63830568-63830590 GCGCCGAGTTTGCCAAGAGTCGG - Intronic
1178263867 21:31124526-31124548 GGGCCAGGCCGGCCATGAGCAGG - Exonic
1181001682 22:19990671-19990693 GCGCCATGTTGCCCTACAGCTGG - Exonic
1182429871 22:30293143-30293165 GTGACAGGTTGGCAGAGAGCAGG - Intronic
1185128491 22:49024736-49024758 GCCCCAGGTTGGGGCAGAGCAGG + Intergenic
949396360 3:3618398-3618420 GCCCCATTTTGGTCAAGAGCTGG - Intergenic
951712821 3:25602572-25602594 GCCCCTCGTTAGCCAAGAGCAGG + Intronic
953397048 3:42581794-42581816 GCGGCCCGTTAGCCAAGAGCAGG - Intronic
955797316 3:62650984-62651006 TCTCCAAGTTGGCCATGAGCAGG + Exonic
968436200 4:590984-591006 GCTCCAAGTTGGCCATGAGGGGG + Intergenic
968448190 4:663042-663064 GCGCAGGGTGGGCCAAGGGCAGG + Intronic
968773432 4:2523818-2523840 TCTCCATGTTGGTCAAGAGCTGG - Intronic
969416928 4:7067125-7067147 GGGCCAAATTGGCCAAAAGCTGG - Intronic
973692880 4:53456852-53456874 GCTCCAGGTTCAACAAGAGCTGG + Intronic
976813374 4:89120606-89120628 GATCCCGTTTGGCCAAGAGCGGG - Intergenic
979832185 4:125316546-125316568 GCGCCAGGTGTTCCAAGTGCTGG + Exonic
983123644 4:163920697-163920719 GAGACAGATGGGCCAAGAGCTGG + Intronic
997199905 5:132003587-132003609 GCCCCAGCCTGGCCAGGAGCCGG - Intronic
997282190 5:132656277-132656299 GCGCCAGGCAGGGCAAGGGCCGG - Intronic
997473904 5:134131806-134131828 GGGCCAGACTGGCCCAGAGCAGG + Intronic
997640917 5:135448436-135448458 GAGCCAGGTACGCCAAGGGCAGG - Exonic
998467106 5:142355348-142355370 TCGCCATGTTGGCCAGGAGATGG + Intergenic
999142756 5:149373472-149373494 CCTCCAGGTTGCCAAAGAGCAGG - Intronic
1000430999 5:161152383-161152405 GACCCAGTTTAGCCAAGAGCAGG - Intergenic
1002395920 5:178954240-178954262 GTGCCAGGCTGGACAACAGCTGG + Intronic
1007953663 6:45896811-45896833 TCTCCAGGCTGACCAAGAGCTGG - Intergenic
1012859843 6:104545892-104545914 GAGCAGGCTTGGCCAAGAGCAGG + Intergenic
1013287544 6:108693979-108694001 GCTGCAGGCTGGCCCAGAGCTGG - Intergenic
1014255839 6:119159494-119159516 GCTTCAGGATGGCCAAGAGGGGG + Intergenic
1019179670 6:170178373-170178395 GGGCCATGTTGGCCACGGGCAGG + Intergenic
1024993380 7:55253548-55253570 GCTCAAGGTTGGCCAGAAGCTGG + Intronic
1029861113 7:103573134-103573156 TTGCCATGTTGGCCAGGAGCTGG + Intronic
1035121030 7:156567270-156567292 GGGCCAGGATGGCCCAGCGCTGG - Intergenic
1038423104 8:27446147-27446169 GCACCAGCATGGCCAAGGGCAGG - Intronic
1039927425 8:41948467-41948489 GCTCCAGGTTGGCCAGGCCCAGG + Intronic
1040330515 8:46383467-46383489 GCCGCAGGTTGGCCATTAGCAGG + Intergenic
1044438083 8:92189586-92189608 AGACTAGGTTGGCCAAGAGCTGG + Intergenic
1049479616 8:142815643-142815665 GAAGCAGGATGGCCAAGAGCAGG - Intergenic
1049724029 8:144137319-144137341 GTGCCAGCCTGGACAAGAGCAGG + Intergenic
1049884424 9:17862-17884 GGGCCAGGATGGCCAAGGGATGG + Intergenic
1053290001 9:36873520-36873542 GGGCCAGGTTGGCAAAGGGGTGG + Intronic
1057772220 9:97978799-97978821 GTGCCTGGTTGGACAGGAGCAGG + Intergenic
1062556691 9:137116031-137116053 ACGCCAGCTAGGCCGAGAGCTGG + Intergenic
1062590414 9:137272124-137272146 GCGCAAGGTTGCCCGTGAGCAGG - Exonic
1186864492 X:13705980-13706002 GAGTGAGGCTGGCCAAGAGCAGG + Intronic
1189198979 X:39175563-39175585 GCTCCTGGTTGGCCAATAACGGG + Intergenic
1189259718 X:39669778-39669800 GCTCCTGGGTGGCCAAGAACGGG - Intergenic
1191779617 X:64851068-64851090 GCGTAAGGTTAGCCAAGAGAAGG - Intergenic
1193596401 X:83451445-83451467 GCTCCATTTTGGCCCAGAGCAGG + Intergenic
1199097196 X:143757481-143757503 GCGCCAGCCTGGCCGAGTGCGGG + Intergenic
1200401382 X:156022294-156022316 GGGCCAGGATGGCCAAGGGATGG - Intergenic