ID: 1070305489

View in Genome Browser
Species Human (GRCh38)
Location 10:75236497-75236519
Sequence TCCATCTGGCCCCCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070305489_1070305491 -4 Left 1070305489 10:75236497-75236519 CCTGCTTTTGGGGGCCAGATGGA No data
Right 1070305491 10:75236516-75236538 TGGATACGAGTGTCTAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070305489 Original CRISPR TCCATCTGGCCCCCAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr