ID: 1070306064

View in Genome Browser
Species Human (GRCh38)
Location 10:75239904-75239926
Sequence CGCTGTCGCCCGAGATCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070306058_1070306064 16 Left 1070306058 10:75239865-75239887 CCTATTTCTCATAGCCCTGCTAG No data
Right 1070306064 10:75239904-75239926 CGCTGTCGCCCGAGATCCCCCGG No data
1070306060_1070306064 2 Left 1070306060 10:75239879-75239901 CCCTGCTAGCATCACACAGGCTG No data
Right 1070306064 10:75239904-75239926 CGCTGTCGCCCGAGATCCCCCGG No data
1070306061_1070306064 1 Left 1070306061 10:75239880-75239902 CCTGCTAGCATCACACAGGCTGG No data
Right 1070306064 10:75239904-75239926 CGCTGTCGCCCGAGATCCCCCGG No data
1070306056_1070306064 22 Left 1070306056 10:75239859-75239881 CCCACTCCTATTTCTCATAGCCC No data
Right 1070306064 10:75239904-75239926 CGCTGTCGCCCGAGATCCCCCGG No data
1070306057_1070306064 21 Left 1070306057 10:75239860-75239882 CCACTCCTATTTCTCATAGCCCT No data
Right 1070306064 10:75239904-75239926 CGCTGTCGCCCGAGATCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070306064 Original CRISPR CGCTGTCGCCCGAGATCCCC CGG Intergenic
No off target data available for this crispr