ID: 1070310056

View in Genome Browser
Species Human (GRCh38)
Location 10:75266432-75266454
Sequence CATTCAAAGGTGAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070310056_1070310061 -8 Left 1070310056 10:75266432-75266454 CCTCCCTCTTTCACCTTTGAATG No data
Right 1070310061 10:75266447-75266469 TTTGAATGACTTCAGGTTCTTGG No data
1070310056_1070310065 26 Left 1070310056 10:75266432-75266454 CCTCCCTCTTTCACCTTTGAATG No data
Right 1070310065 10:75266481-75266503 ACTCATAGCTTCATGCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070310056 Original CRISPR CATTCAAAGGTGAAAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr