ID: 1070310061

View in Genome Browser
Species Human (GRCh38)
Location 10:75266447-75266469
Sequence TTTGAATGACTTCAGGTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070310055_1070310061 -1 Left 1070310055 10:75266425-75266447 CCTGCTTCCTCCCTCTTTCACCT No data
Right 1070310061 10:75266447-75266469 TTTGAATGACTTCAGGTTCTTGG No data
1070310056_1070310061 -8 Left 1070310056 10:75266432-75266454 CCTCCCTCTTTCACCTTTGAATG No data
Right 1070310061 10:75266447-75266469 TTTGAATGACTTCAGGTTCTTGG No data
1070310052_1070310061 26 Left 1070310052 10:75266398-75266420 CCTTAGCCAGCTAGGATTTCTCC No data
Right 1070310061 10:75266447-75266469 TTTGAATGACTTCAGGTTCTTGG No data
1070310053_1070310061 20 Left 1070310053 10:75266404-75266426 CCAGCTAGGATTTCTCCATCTCC No data
Right 1070310061 10:75266447-75266469 TTTGAATGACTTCAGGTTCTTGG No data
1070310054_1070310061 5 Left 1070310054 10:75266419-75266441 CCATCTCCTGCTTCCTCCCTCTT No data
Right 1070310061 10:75266447-75266469 TTTGAATGACTTCAGGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070310061 Original CRISPR TTTGAATGACTTCAGGTTCT TGG Intergenic
No off target data available for this crispr