ID: 1070310065

View in Genome Browser
Species Human (GRCh38)
Location 10:75266481-75266503
Sequence ACTCATAGCTTCATGCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070310060_1070310065 13 Left 1070310060 10:75266445-75266467 CCTTTGAATGACTTCAGGTTCTT No data
Right 1070310065 10:75266481-75266503 ACTCATAGCTTCATGCCTTCAGG No data
1070310058_1070310065 22 Left 1070310058 10:75266436-75266458 CCTCTTTCACCTTTGAATGACTT No data
Right 1070310065 10:75266481-75266503 ACTCATAGCTTCATGCCTTCAGG No data
1070310056_1070310065 26 Left 1070310056 10:75266432-75266454 CCTCCCTCTTTCACCTTTGAATG No data
Right 1070310065 10:75266481-75266503 ACTCATAGCTTCATGCCTTCAGG No data
1070310057_1070310065 23 Left 1070310057 10:75266435-75266457 CCCTCTTTCACCTTTGAATGACT No data
Right 1070310065 10:75266481-75266503 ACTCATAGCTTCATGCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070310065 Original CRISPR ACTCATAGCTTCATGCCTTC AGG Intergenic
No off target data available for this crispr