ID: 1070310887

View in Genome Browser
Species Human (GRCh38)
Location 10:75273045-75273067
Sequence GCCTGGACACAGTTTCGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070310879_1070310887 29 Left 1070310879 10:75272993-75273015 CCACTGACAGGGTGATGGAAAGC No data
Right 1070310887 10:75273045-75273067 GCCTGGACACAGTTTCGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070310887 Original CRISPR GCCTGGACACAGTTTCGGCT GGG Intergenic
No off target data available for this crispr