ID: 1070312436

View in Genome Browser
Species Human (GRCh38)
Location 10:75283514-75283536
Sequence GGCCTGCCTCTTCCTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070312426_1070312436 14 Left 1070312426 10:75283477-75283499 CCAAGGACAAAAGCTCAGCCTGG No data
Right 1070312436 10:75283514-75283536 GGCCTGCCTCTTCCTGAGGGTGG No data
1070312432_1070312436 -4 Left 1070312432 10:75283495-75283517 CCTGGAGCATTCCAGGAGGGGCC No data
Right 1070312436 10:75283514-75283536 GGCCTGCCTCTTCCTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070312436 Original CRISPR GGCCTGCCTCTTCCTGAGGG TGG Intergenic
No off target data available for this crispr