ID: 1070312579

View in Genome Browser
Species Human (GRCh38)
Location 10:75284353-75284375
Sequence CAGAAGAGGGAGCAGCAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070312570_1070312579 9 Left 1070312570 10:75284321-75284343 CCTAAGAGAGCAGACAGTAGGGA No data
Right 1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG No data
1070312567_1070312579 13 Left 1070312567 10:75284317-75284339 CCAGCCTAAGAGAGCAGACAGTA No data
Right 1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG No data
1070312566_1070312579 23 Left 1070312566 10:75284307-75284329 CCATAACAAACCAGCCTAAGAGA No data
Right 1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070312579 Original CRISPR CAGAAGAGGGAGCAGCAGGC GGG Intergenic
No off target data available for this crispr