ID: 1070313072

View in Genome Browser
Species Human (GRCh38)
Location 10:75287702-75287724
Sequence ATGGAGCAGCAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070313072_1070313079 18 Left 1070313072 10:75287702-75287724 CCCTCCTCATTCTGCTGCTCCAT No data
Right 1070313079 10:75287743-75287765 GCCCAGCTTTTCCTCACATCAGG No data
1070313072_1070313082 24 Left 1070313072 10:75287702-75287724 CCCTCCTCATTCTGCTGCTCCAT No data
Right 1070313082 10:75287749-75287771 CTTTTCCTCACATCAGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070313072 Original CRISPR ATGGAGCAGCAGAATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr