ID: 1070313082

View in Genome Browser
Species Human (GRCh38)
Location 10:75287749-75287771
Sequence CTTTTCCTCACATCAGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070313073_1070313082 23 Left 1070313073 10:75287703-75287725 CCTCCTCATTCTGCTGCTCCATG No data
Right 1070313082 10:75287749-75287771 CTTTTCCTCACATCAGGTCATGG No data
1070313074_1070313082 20 Left 1070313074 10:75287706-75287728 CCTCATTCTGCTGCTCCATGTTG No data
Right 1070313082 10:75287749-75287771 CTTTTCCTCACATCAGGTCATGG No data
1070313072_1070313082 24 Left 1070313072 10:75287702-75287724 CCCTCCTCATTCTGCTGCTCCAT No data
Right 1070313082 10:75287749-75287771 CTTTTCCTCACATCAGGTCATGG No data
1070313075_1070313082 5 Left 1070313075 10:75287721-75287743 CCATGTTGATTTCATTCCCTCCG No data
Right 1070313082 10:75287749-75287771 CTTTTCCTCACATCAGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070313082 Original CRISPR CTTTTCCTCACATCAGGTCA TGG Intergenic
No off target data available for this crispr