ID: 1070313293

View in Genome Browser
Species Human (GRCh38)
Location 10:75289002-75289024
Sequence GTTACCATGGGGAAGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070313286_1070313293 -7 Left 1070313286 10:75288986-75289008 CCCAGCTCTCTTGTGAGTTACCA No data
Right 1070313293 10:75289002-75289024 GTTACCATGGGGAAGGCTGGAGG No data
1070313284_1070313293 14 Left 1070313284 10:75288965-75288987 CCATGGACCTCTCTGAACTGGCC No data
Right 1070313293 10:75289002-75289024 GTTACCATGGGGAAGGCTGGAGG No data
1070313282_1070313293 20 Left 1070313282 10:75288959-75288981 CCACTTCCATGGACCTCTCTGAA No data
Right 1070313293 10:75289002-75289024 GTTACCATGGGGAAGGCTGGAGG No data
1070313287_1070313293 -8 Left 1070313287 10:75288987-75289009 CCAGCTCTCTTGTGAGTTACCAT No data
Right 1070313293 10:75289002-75289024 GTTACCATGGGGAAGGCTGGAGG No data
1070313285_1070313293 7 Left 1070313285 10:75288972-75288994 CCTCTCTGAACTGGCCCAGCTCT No data
Right 1070313293 10:75289002-75289024 GTTACCATGGGGAAGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070313293 Original CRISPR GTTACCATGGGGAAGGCTGG AGG Intergenic
No off target data available for this crispr