ID: 1070321172

View in Genome Browser
Species Human (GRCh38)
Location 10:75355776-75355798
Sequence CTATGGGTCTGGAATTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070321165_1070321172 23 Left 1070321165 10:75355730-75355752 CCCAAATTTAGTGGTGTAAAACA 0: 3
1: 17
2: 148
3: 680
4: 1641
Right 1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG No data
1070321168_1070321172 -1 Left 1070321168 10:75355754-75355776 CCATTTATTATGTTTATAGGTTC No data
Right 1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG No data
1070321164_1070321172 24 Left 1070321164 10:75355729-75355751 CCCCAAATTTAGTGGTGTAAAAC No data
Right 1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG No data
1070321166_1070321172 22 Left 1070321166 10:75355731-75355753 CCAAATTTAGTGGTGTAAAACAA No data
Right 1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070321172 Original CRISPR CTATGGGTCTGGAATTCAGA TGG Intergenic
No off target data available for this crispr