ID: 1070321299

View in Genome Browser
Species Human (GRCh38)
Location 10:75356718-75356740
Sequence CCTCAATGGGAGAACCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070321299_1070321308 13 Left 1070321299 10:75356718-75356740 CCACCCAGGTTCTCCCATTGAGG No data
Right 1070321308 10:75356754-75356776 TATCAAGATGAGAGAACTTTGGG No data
1070321299_1070321307 12 Left 1070321299 10:75356718-75356740 CCACCCAGGTTCTCCCATTGAGG No data
Right 1070321307 10:75356753-75356775 TTATCAAGATGAGAGAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070321299 Original CRISPR CCTCAATGGGAGAACCTGGG TGG (reversed) Intergenic
No off target data available for this crispr