ID: 1070323265

View in Genome Browser
Species Human (GRCh38)
Location 10:75370997-75371019
Sequence CACTTTTCTCACTTTGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070323265_1070323272 0 Left 1070323265 10:75370997-75371019 CCTAGCTCAAAGTGAGAAAAGTG No data
Right 1070323272 10:75371020-75371042 AGGGGCAGGAAAAAGGGTCCAGG No data
1070323265_1070323273 1 Left 1070323265 10:75370997-75371019 CCTAGCTCAAAGTGAGAAAAGTG No data
Right 1070323273 10:75371021-75371043 GGGGCAGGAAAAAGGGTCCAGGG No data
1070323265_1070323270 -7 Left 1070323265 10:75370997-75371019 CCTAGCTCAAAGTGAGAAAAGTG No data
Right 1070323270 10:75371013-75371035 AAAAGTGAGGGGCAGGAAAAAGG No data
1070323265_1070323271 -6 Left 1070323265 10:75370997-75371019 CCTAGCTCAAAGTGAGAAAAGTG No data
Right 1070323271 10:75371014-75371036 AAAGTGAGGGGCAGGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070323265 Original CRISPR CACTTTTCTCACTTTGAGCT AGG (reversed) Intergenic
No off target data available for this crispr