ID: 1070327579

View in Genome Browser
Species Human (GRCh38)
Location 10:75398760-75398782
Sequence ACTGACCACCGCCTCGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 42}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070327579_1070327592 26 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327592 10:75398809-75398831 GTAGTACGGTCCGGTGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1070327579_1070327584 0 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327584 10:75398783-75398805 CTCTGTCCGTAGAGGGCGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1070327579_1070327593 27 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327593 10:75398810-75398832 TAGTACGGTCCGGTGGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 20
1070327579_1070327588 12 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327588 10:75398795-75398817 AGGGCGTAGGGGGAGTAGTACGG 0: 1
1: 0
2: 0
3: 10
4: 164
1070327579_1070327585 1 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327585 10:75398784-75398806 TCTGTCCGTAGAGGGCGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1070327579_1070327591 23 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327591 10:75398806-75398828 GGAGTAGTACGGTCCGGTGGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1070327579_1070327583 -1 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327583 10:75398782-75398804 TCTCTGTCCGTAGAGGGCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 74
1070327579_1070327582 -7 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327582 10:75398776-75398798 GGTCAGTCTCTGTCCGTAGAGGG 0: 1
1: 0
2: 1
3: 4
4: 65
1070327579_1070327590 20 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327590 10:75398803-75398825 GGGGGAGTAGTACGGTCCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 22
1070327579_1070327581 -8 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327581 10:75398775-75398797 TGGTCAGTCTCTGTCCGTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 57
1070327579_1070327589 17 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327589 10:75398800-75398822 GTAGGGGGAGTAGTACGGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 42
1070327579_1070327586 2 Left 1070327579 10:75398760-75398782 CCAGCGCCGAGGCGGTGGTCAGT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1070327586 10:75398785-75398807 CTGTCCGTAGAGGGCGTAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070327579 Original CRISPR ACTGACCACCGCCTCGGCGC TGG (reversed) Exonic
903330256 1:22593502-22593524 ACTGACCACCGTCCCGTGGCAGG + Exonic
907238008 1:53064488-53064510 ACTGACCACCTGCTCTGTGCTGG - Intronic
908790249 1:67774010-67774032 AATGACGACTGCCTCGGTGCAGG - Intronic
1067342674 10:45418116-45418138 TCTGAGCACCGCCTCTGTGCTGG + Intronic
1070302183 10:75211321-75211343 TCTGACCACCTCCTCTGCGGAGG + Intronic
1070327579 10:75398760-75398782 ACTGACCACCGCCTCGGCGCTGG - Exonic
1076790300 10:132773669-132773691 ACTGTCCTCCCCCTCGGCACAGG - Intronic
1077486675 11:2841899-2841921 ACTGACCACCCCCCAGGAGCGGG - Intronic
1078579058 11:12524931-12524953 CCTGACCCCCGCCTGGGCGCAGG - Intronic
1084165131 11:67372098-67372120 ACTGACCTCCGCCACAGCTCGGG - Intronic
1104344417 12:127983243-127983265 TCTGAGCACCTCCTCGGCCCTGG + Intergenic
1117571005 14:57049297-57049319 ACTGACCACCCCCGCGGGGAGGG + Intergenic
1118355057 14:65006644-65006666 ACTGTCCACTGCCTGGGCTCTGG + Intronic
1122723008 14:103732538-103732560 GCTGGCCACCGCCTTGGGGCTGG + Intronic
1124109621 15:26773443-26773465 ACTGTCGGCAGCCTCGGCGCCGG + Intronic
1124373978 15:29118984-29119006 ACTGACCACCTTCACGGCCCAGG + Intergenic
1124641607 15:31399633-31399655 ACTAACCTCCGCCTCGTGGCTGG + Intronic
1127988832 15:64096156-64096178 ACTCACGACCACCGCGGCGCCGG - Exonic
1129276516 15:74449233-74449255 GCTGGCCACCGCCTTGGCCCTGG - Exonic
1136512705 16:30748781-30748803 ACTGCCCTCCTCCTCCGCGCAGG + Exonic
1145932865 17:28698429-28698451 CCTGACCACCGCTTCAGTGCGGG - Intronic
1148021781 17:44558177-44558199 ACTCACCACCGCGCCGCCGCCGG + Exonic
1149595442 17:57862196-57862218 ACTGACCACTGCCACGGGGAGGG - Exonic
1151858270 17:76737955-76737977 CCTGACCGCAGCCGCGGCGCCGG - Exonic
1154070531 18:11148702-11148724 CCCGAGCATCGCCTCGGCGCGGG + Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1161069380 19:2252731-2252753 TCTGACCTCTGCCTCGGCCCGGG + Exonic
1167357803 19:49014811-49014833 CCTGACCACCCCCAGGGCGCTGG - Intronic
1167710548 19:51107955-51107977 ACTGAGCACCGACTCTGCGCAGG - Intronic
940279303 2:151973120-151973142 ACTGCCCACTGCCTCTGCACTGG + Intronic
946622025 2:221571953-221571975 ACGGGTCACCGCCTCGGGGCAGG + Intronic
948761048 2:240191212-240191234 GCTGAGCACCGCCTTGGCGCTGG + Intergenic
1179209329 21:39312925-39312947 AGTGACCACCCCTCCGGCGCGGG + Intronic
1179812605 21:43882143-43882165 ACTGACCACTCCCTCAGCCCTGG - Intronic
1181519499 22:23437035-23437057 AGTGACCACCACCTCGACCCCGG + Intergenic
951981873 3:28575570-28575592 GGTGACCCCCGCCTCCGCGCTGG - Intergenic
953083647 3:39645527-39645549 GCTGGCCACCACCTCGGCCCTGG - Intergenic
973264541 4:48198226-48198248 CCTGACCATCGCCCTGGCGCCGG - Intronic
975689587 4:76950308-76950330 CCTGAGCGCCCCCTCGGCGCGGG - Intronic
1001317920 5:170657429-170657451 ACCCACCACCGCCTTGGCTCAGG + Intronic
1006378055 6:33682750-33682772 ACTGACAACCACCTGGGAGCAGG - Intronic
1007241773 6:40431802-40431824 AGTGACCACCACCTCGGCCCTGG - Exonic
1020105560 7:5420878-5420900 ACTCTCCACCGCCTTGGCTCCGG + Intronic
1022113498 7:27245051-27245073 GCCGACCAGCGCCTCGGAGCCGG - Exonic
1022644060 7:32214823-32214845 ATTGAGCACCACCTGGGCGCTGG + Intronic
1049599273 8:143499457-143499479 ACTGAACACCGGCTGGGCGCAGG - Intronic
1051898008 9:22008881-22008903 TCTGGCCAGCGCCGCGGCGCGGG - Exonic
1187237892 X:17485431-17485453 ACTGACCTCAGCCTCAGCTCTGG - Intronic