ID: 1070329135

View in Genome Browser
Species Human (GRCh38)
Location 10:75405495-75405517
Sequence CGCTCCCAGGGACCGCGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070329135_1070329144 14 Left 1070329135 10:75405495-75405517 CCGCCTCGCGGTCCCTGGGAGCG No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data
1070329135_1070329143 0 Left 1070329135 10:75405495-75405517 CCGCCTCGCGGTCCCTGGGAGCG No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329135_1070329142 -3 Left 1070329135 10:75405495-75405517 CCGCCTCGCGGTCCCTGGGAGCG No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070329135 Original CRISPR CGCTCCCAGGGACCGCGAGG CGG (reversed) Intergenic
No off target data available for this crispr