ID: 1070329142

View in Genome Browser
Species Human (GRCh38)
Location 10:75405515-75405537
Sequence GCGGGGAGAGAAAGCGCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070329120_1070329142 26 Left 1070329120 10:75405466-75405488 CCCGGGGGCCTCCCCACCCCTGT No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329127_1070329142 9 Left 1070329127 10:75405483-75405505 CCCTGTCCTGCCCCGCCTCGCGG No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329121_1070329142 25 Left 1070329121 10:75405467-75405489 CCGGGGGCCTCCCCACCCCTGTC No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329135_1070329142 -3 Left 1070329135 10:75405495-75405517 CCGCCTCGCGGTCCCTGGGAGCG No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329133_1070329142 -1 Left 1070329133 10:75405493-75405515 CCCCGCCTCGCGGTCCCTGGGAG No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329126_1070329142 10 Left 1070329126 10:75405482-75405504 CCCCTGTCCTGCCCCGCCTCGCG No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329118_1070329142 28 Left 1070329118 10:75405464-75405486 CCCCCGGGGGCCTCCCCACCCCT No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329124_1070329142 14 Left 1070329124 10:75405478-75405500 CCCACCCCTGTCCTGCCCCGCCT No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329125_1070329142 13 Left 1070329125 10:75405479-75405501 CCACCCCTGTCCTGCCCCGCCTC No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329134_1070329142 -2 Left 1070329134 10:75405494-75405516 CCCGCCTCGCGGTCCCTGGGAGC No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329122_1070329142 18 Left 1070329122 10:75405474-75405496 CCTCCCCACCCCTGTCCTGCCCC No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329130_1070329142 3 Left 1070329130 10:75405489-75405511 CCTGCCCCGCCTCGCGGTCCCTG No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329129_1070329142 8 Left 1070329129 10:75405484-75405506 CCTGTCCTGCCCCGCCTCGCGGT No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329119_1070329142 27 Left 1070329119 10:75405465-75405487 CCCCGGGGGCCTCCCCACCCCTG No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329123_1070329142 15 Left 1070329123 10:75405477-75405499 CCCCACCCCTGTCCTGCCCCGCC No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data
1070329138_1070329142 -6 Left 1070329138 10:75405498-75405520 CCTCGCGGTCCCTGGGAGCGGGG No data
Right 1070329142 10:75405515-75405537 GCGGGGAGAGAAAGCGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070329142 Original CRISPR GCGGGGAGAGAAAGCGCGCG CGG Intergenic
No off target data available for this crispr