ID: 1070329143

View in Genome Browser
Species Human (GRCh38)
Location 10:75405518-75405540
Sequence GGGAGAGAAAGCGCGCGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070329130_1070329143 6 Left 1070329130 10:75405489-75405511 CCTGCCCCGCCTCGCGGTCCCTG No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329129_1070329143 11 Left 1070329129 10:75405484-75405506 CCTGTCCTGCCCCGCCTCGCGGT No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329119_1070329143 30 Left 1070329119 10:75405465-75405487 CCCCGGGGGCCTCCCCACCCCTG No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329124_1070329143 17 Left 1070329124 10:75405478-75405500 CCCACCCCTGTCCTGCCCCGCCT No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329133_1070329143 2 Left 1070329133 10:75405493-75405515 CCCCGCCTCGCGGTCCCTGGGAG No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329122_1070329143 21 Left 1070329122 10:75405474-75405496 CCTCCCCACCCCTGTCCTGCCCC No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329125_1070329143 16 Left 1070329125 10:75405479-75405501 CCACCCCTGTCCTGCCCCGCCTC No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329134_1070329143 1 Left 1070329134 10:75405494-75405516 CCCGCCTCGCGGTCCCTGGGAGC No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329121_1070329143 28 Left 1070329121 10:75405467-75405489 CCGGGGGCCTCCCCACCCCTGTC No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329126_1070329143 13 Left 1070329126 10:75405482-75405504 CCCCTGTCCTGCCCCGCCTCGCG No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329123_1070329143 18 Left 1070329123 10:75405477-75405499 CCCCACCCCTGTCCTGCCCCGCC No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329138_1070329143 -3 Left 1070329138 10:75405498-75405520 CCTCGCGGTCCCTGGGAGCGGGG No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329127_1070329143 12 Left 1070329127 10:75405483-75405505 CCCTGTCCTGCCCCGCCTCGCGG No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329120_1070329143 29 Left 1070329120 10:75405466-75405488 CCCGGGGGCCTCCCCACCCCTGT No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data
1070329135_1070329143 0 Left 1070329135 10:75405495-75405517 CCGCCTCGCGGTCCCTGGGAGCG No data
Right 1070329143 10:75405518-75405540 GGGAGAGAAAGCGCGCGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070329143 Original CRISPR GGGAGAGAAAGCGCGCGCGG AGG Intergenic
No off target data available for this crispr