ID: 1070329144

View in Genome Browser
Species Human (GRCh38)
Location 10:75405532-75405554
Sequence GCGCGGAGGCCTCTGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070329140_1070329144 2 Left 1070329140 10:75405507-75405529 CCCTGGGAGCGGGGAGAGAAAGC No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data
1070329129_1070329144 25 Left 1070329129 10:75405484-75405506 CCTGTCCTGCCCCGCCTCGCGGT No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data
1070329130_1070329144 20 Left 1070329130 10:75405489-75405511 CCTGCCCCGCCTCGCGGTCCCTG No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data
1070329127_1070329144 26 Left 1070329127 10:75405483-75405505 CCCTGTCCTGCCCCGCCTCGCGG No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data
1070329134_1070329144 15 Left 1070329134 10:75405494-75405516 CCCGCCTCGCGGTCCCTGGGAGC No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data
1070329133_1070329144 16 Left 1070329133 10:75405493-75405515 CCCCGCCTCGCGGTCCCTGGGAG No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data
1070329126_1070329144 27 Left 1070329126 10:75405482-75405504 CCCCTGTCCTGCCCCGCCTCGCG No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data
1070329125_1070329144 30 Left 1070329125 10:75405479-75405501 CCACCCCTGTCCTGCCCCGCCTC No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data
1070329135_1070329144 14 Left 1070329135 10:75405495-75405517 CCGCCTCGCGGTCCCTGGGAGCG No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data
1070329141_1070329144 1 Left 1070329141 10:75405508-75405530 CCTGGGAGCGGGGAGAGAAAGCG No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data
1070329138_1070329144 11 Left 1070329138 10:75405498-75405520 CCTCGCGGTCCCTGGGAGCGGGG No data
Right 1070329144 10:75405532-75405554 GCGCGGAGGCCTCTGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070329144 Original CRISPR GCGCGGAGGCCTCTGCACCC AGG Intergenic
No off target data available for this crispr