ID: 1070330982

View in Genome Browser
Species Human (GRCh38)
Location 10:75416987-75417009
Sequence GGCCTTATAGGATTGTTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070330982_1070330988 16 Left 1070330982 10:75416987-75417009 CCTCGCAACAATCCTATAAGGCC No data
Right 1070330988 10:75417026-75417048 TTTTACAGATGACGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070330982 Original CRISPR GGCCTTATAGGATTGTTGCG AGG (reversed) Intergenic