ID: 1070332598

View in Genome Browser
Species Human (GRCh38)
Location 10:75429116-75429138
Sequence AAGAACAAGGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070332598_1070332604 15 Left 1070332598 10:75429116-75429138 CCCTCCTCCTTCTCCTTGTTCTT No data
Right 1070332604 10:75429154-75429176 ACTCCAAAAGCTGAGGAGTAAGG No data
1070332598_1070332606 20 Left 1070332598 10:75429116-75429138 CCCTCCTCCTTCTCCTTGTTCTT No data
Right 1070332606 10:75429159-75429181 AAAAGCTGAGGAGTAAGGACAGG No data
1070332598_1070332603 8 Left 1070332598 10:75429116-75429138 CCCTCCTCCTTCTCCTTGTTCTT No data
Right 1070332603 10:75429147-75429169 AAGACTAACTCCAAAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070332598 Original CRISPR AAGAACAAGGAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr