ID: 1070333159

View in Genome Browser
Species Human (GRCh38)
Location 10:75431956-75431978
Sequence GTGCGGGAAGAACACCCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070333146_1070333159 29 Left 1070333146 10:75431904-75431926 CCCTAGTGGGGCTAGGACAGACC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1070333159 10:75431956-75431978 GTGCGGGAAGAACACCCGCAAGG No data
1070333147_1070333159 28 Left 1070333147 10:75431905-75431927 CCTAGTGGGGCTAGGACAGACCT 0: 1
1: 0
2: 2
3: 8
4: 116
Right 1070333159 10:75431956-75431978 GTGCGGGAAGAACACCCGCAAGG No data
1070333152_1070333159 -4 Left 1070333152 10:75431937-75431959 CCTGGCACACCCCCTTGATGTGC 0: 1
1: 0
2: 0
3: 6
4: 168
Right 1070333159 10:75431956-75431978 GTGCGGGAAGAACACCCGCAAGG No data
1070333151_1070333159 8 Left 1070333151 10:75431925-75431947 CCTCGTTTCGGGCCTGGCACACC 0: 1
1: 0
2: 0
3: 0
4: 82
Right 1070333159 10:75431956-75431978 GTGCGGGAAGAACACCCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070333159 Original CRISPR GTGCGGGAAGAACACCCGCA AGG Intronic
No off target data available for this crispr