ID: 1070334176

View in Genome Browser
Species Human (GRCh38)
Location 10:75439859-75439881
Sequence CTAAGTCTGCTCTGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070334176_1070334183 4 Left 1070334176 10:75439859-75439881 CCAGCTTCCCAGAGCAGACTTAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1070334183 10:75439886-75439908 AAGGCTTCCTTTCCTGGGCATGG No data
1070334176_1070334184 8 Left 1070334176 10:75439859-75439881 CCAGCTTCCCAGAGCAGACTTAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1070334184 10:75439890-75439912 CTTCCTTTCCTGGGCATGGAAGG No data
1070334176_1070334182 -1 Left 1070334176 10:75439859-75439881 CCAGCTTCCCAGAGCAGACTTAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1070334182 10:75439881-75439903 GGCAAAAGGCTTCCTTTCCTGGG No data
1070334176_1070334181 -2 Left 1070334176 10:75439859-75439881 CCAGCTTCCCAGAGCAGACTTAG 0: 1
1: 0
2: 2
3: 17
4: 191
Right 1070334181 10:75439880-75439902 AGGCAAAAGGCTTCCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070334176 Original CRISPR CTAAGTCTGCTCTGGGAAGC TGG (reversed) Intronic
900112337 1:1013700-1013722 CTAAGTGTGCTCCTGAAAGCAGG + Intronic
901570979 1:10160450-10160472 GTAAGCCTGCTCTGGGAAGCAGG + Intronic
902681817 1:18049057-18049079 CTAAGACTGCAAAGGGAAGCGGG + Intergenic
902991829 1:20193163-20193185 CTATGTCTGATCTAGGAGGCTGG + Exonic
903324040 1:22559489-22559511 CCAAGCCTGCTCTGGGATGTGGG + Intergenic
903857846 1:26347123-26347145 CTAACTCTGTTCAGGGAAGATGG + Intronic
904420561 1:30388353-30388375 CTAATGCTGGTCTGGCAAGCAGG - Intergenic
906106002 1:43293023-43293045 CTAATTCCTCTCTGGGAGGCTGG - Intergenic
906539849 1:46576912-46576934 CTCAGTCTCCCCTGGGCAGCTGG - Intronic
906697458 1:47832867-47832889 CTAACTCTGCTTTGAGGAGCTGG + Intronic
907207329 1:52784808-52784830 ATAATTCTGCTCTGTGAAGAGGG + Intronic
907381826 1:54096985-54097007 ATAAGTGAGCTCTGGGAAGAAGG - Exonic
910623330 1:89279864-89279886 CAAAATCTGCTCTTGTAAGCAGG + Intergenic
911247282 1:95532579-95532601 CCCAGTCTTCCCTGGGAAGCTGG - Intergenic
914290810 1:146271345-146271367 CTAAGTCTGCTGAGGGGAGAGGG - Intergenic
914551854 1:148722128-148722150 CTAAGTCTGCTGAGGGGAGAGGG - Intergenic
915525782 1:156475515-156475537 CTCACTCTGCACTGGGAGGCTGG - Intronic
917121962 1:171652414-171652436 CTGGCTCTGCTCTGGGCAGCTGG + Exonic
918694082 1:187521280-187521302 CACAGTCAGCTCTGGAAAGCTGG - Intergenic
920395009 1:205638733-205638755 CTAAGTCTGCTCTGGAGGTCAGG - Intergenic
923645365 1:235815071-235815093 CTAAGTTTACTAAGGGAAGCAGG - Intronic
923653105 1:235892192-235892214 CTAAGTCTGGGCTGGGTAGTTGG - Intergenic
1063393320 10:5664238-5664260 CTGCTGCTGCTCTGGGAAGCCGG - Intronic
1065898099 10:30182214-30182236 CGAAGCCTGCTGTGGGAAGCAGG - Intergenic
1069735796 10:70653310-70653332 CCAAGTCAGCACTGGGAAGCTGG - Intergenic
1069820797 10:71226560-71226582 TTAAGGCAGCTCTGGGAAGCAGG - Intronic
1070334176 10:75439859-75439881 CTAAGTCTGCTCTGGGAAGCTGG - Intronic
1070582011 10:77728249-77728271 CTAAGTCTTCACTGAGAACCTGG - Intergenic
1072225723 10:93367162-93367184 CCAAGGCCTCTCTGGGAAGCAGG + Intronic
1074859857 10:117501895-117501917 CTGACTCTGCTCTTGGGAGCTGG + Intergenic
1075776974 10:124995408-124995430 TGAAAACTGCTCTGGGAAGCTGG - Intronic
1075918083 10:126186881-126186903 CTCAAGCAGCTCTGGGAAGCAGG + Intronic
1076343924 10:129767715-129767737 CCTAGTGTGCTCTGGGCAGCAGG + Exonic
1077150512 11:1071049-1071071 CTGAGTCTGCCCTGGAGAGCTGG + Intergenic
1077469305 11:2749367-2749389 CTCAGTCTGCACTGGGAATGGGG + Intronic
1078156975 11:8807692-8807714 GTGACTCAGCTCTGGGAAGCCGG + Intronic
1081968762 11:47184939-47184961 CTGTGTTTGCTCTGGGAGGCCGG - Intronic
1084558735 11:69890768-69890790 CTCAGGCTTCTCTTGGAAGCAGG - Intergenic
1086132194 11:83412523-83412545 CAAATTCTGCCCTAGGAAGCTGG - Intergenic
1089068518 11:115680388-115680410 CTAAGACTCCTCTGGAAAGGGGG + Intergenic
1090490901 11:127159738-127159760 CCAAGGCTGCTCAGGGCAGCTGG + Intergenic
1090966247 11:131599882-131599904 CTAACTCTGCCCAGGGAGGCAGG - Intronic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1096477245 12:51915768-51915790 CCAGGTCTGCTCTGTGAAGTGGG + Intronic
1097532790 12:60826327-60826349 CTAAGGTTTCTCTGGGAAGAAGG - Intergenic
1098015950 12:66104686-66104708 TTAAGTCAGCTCTGGGAAATAGG + Intergenic
1098590240 12:72202479-72202501 CTATTTCTACTGTGGGAAGCTGG + Intronic
1101489305 12:105196947-105196969 CTAAAGCTGCTCTGCCAAGCTGG + Intronic
1103054080 12:117804949-117804971 CTGAGTGGGCTCTGGGCAGCAGG - Intronic
1104267878 12:127253623-127253645 CAAATGCTGCTCTGGGAAGCCGG - Intergenic
1106585405 13:31052679-31052701 ATAAGGCTGCTCTGGGATGCAGG + Intergenic
1109767884 13:66928690-66928712 CCATGTCTGATCTAGGAAGCAGG + Intronic
1110033824 13:70654014-70654036 CTAAGGCTGCACTGAGCAGCAGG - Intergenic
1115248613 14:31321899-31321921 CTAATTCTGCCCTGAGTAGCTGG - Intronic
1115848578 14:37567220-37567242 ATATATCTTCTCTGGGAAGCTGG + Intergenic
1117047595 14:51828702-51828724 CTAAGGCTGGACTGTGAAGCTGG + Intronic
1117109149 14:52430398-52430420 CTAAGTCTGTTCTGTGTAACAGG - Intergenic
1117275734 14:54191219-54191241 CTAATTTTGATCTGGGAATCAGG - Intergenic
1117283173 14:54260290-54260312 CTAAGGCAGCTCTCGGAAGCTGG + Intergenic
1117844209 14:59894048-59894070 CTCAGACTTATCTGGGAAGCAGG - Intergenic
1117970001 14:61242190-61242212 CCAAATTTGCTCTGGGGAGCTGG + Intronic
1118773811 14:68960951-68960973 CTAAGCCTCCTCTGAGTAGCTGG - Intronic
1118882783 14:69843112-69843134 CTAATCCTGTTCTGGGGAGCAGG - Intergenic
1119567871 14:75644230-75644252 CTAGGTTATCTCTGGGAAGCAGG - Intronic
1119759849 14:77142458-77142480 CTCAGCCTGATCTGTGAAGCTGG + Intronic
1120264039 14:82226361-82226383 CTAAATCTGCTCAGGACAGCAGG - Intergenic
1121684832 14:95828037-95828059 CTCAGCCTGCAATGGGAAGCGGG - Intergenic
1121818497 14:96946313-96946335 CTATGTATGAACTGGGAAGCAGG - Intergenic
1124159197 15:27253597-27253619 TTAAGCATCCTCTGGGAAGCTGG + Intronic
1124378042 15:29141014-29141036 CTCAGTCTGCTCCGGGGAGAGGG + Intronic
1125553335 15:40564558-40564580 CTAAGTCTCCTCTTGAAAGAAGG - Intronic
1125821350 15:42634797-42634819 CTAAATCTGCTATGAGAAGAAGG + Intronic
1126296264 15:47139379-47139401 GTAAGCCTGCTTTGGGAATCAGG + Intergenic
1127854114 15:62940969-62940991 TTATGTCTGCTCTGAGGAGCTGG + Intergenic
1128175030 15:65547608-65547630 CAAAGGCTGATCTTGGAAGCAGG + Intronic
1131017483 15:89070107-89070129 GTAACTCTGCTCTGGGATCCAGG + Intergenic
1131232161 15:90667183-90667205 CTCAGTCTGCCCTGGGGATCTGG - Intergenic
1132116325 15:99138805-99138827 CTGAGTCTGCTCAGGGAAACAGG - Intronic
1133893152 16:9900689-9900711 CTCAGGCTGCTCTTGGAACCTGG + Intronic
1135932089 16:26746999-26747021 AGAAGTCTCCTCTGGGAAACAGG - Intergenic
1136519103 16:30785016-30785038 CTCTGTCTCCTCTGGGAAACTGG - Intronic
1140255636 16:73333966-73333988 GTAAGTCTAGTCTGGGATGCTGG + Intergenic
1143056914 17:4169444-4169466 TCCAGTCTCCTCTGGGAAGCTGG - Intronic
1143329472 17:6122578-6122600 CTAGGCTTGCTCTGGGATGCAGG - Exonic
1144775888 17:17784357-17784379 CCACGACTCCTCTGGGAAGCTGG + Intronic
1145937940 17:28726135-28726157 CTAGGTCTGTTCTGGGAACCGGG + Exonic
1145944333 17:28761636-28761658 CAACTCCTGCTCTGGGAAGCAGG + Intronic
1146643163 17:34556196-34556218 CTTATTTTCCTCTGGGAAGCTGG - Intergenic
1149378380 17:56068347-56068369 CTAAGGCTGCTGCTGGAAGCTGG + Intergenic
1150120490 17:62597434-62597456 TTAAGTCAGCTCTTGGAAACTGG + Intronic
1152129348 17:78466664-78466686 CTCAGTCTCCTCCAGGAAGCGGG + Exonic
1152299136 17:79485216-79485238 CCAGGACTGCTCTGGGAAGGAGG - Intronic
1152460111 17:80438184-80438206 CCAAGGCTGCTCTGGGGAGGGGG + Intergenic
1153231195 18:2937752-2937774 CTAAGGCTGCGTTGGGAAGGTGG + Exonic
1153805524 18:8706028-8706050 CCAAGGCTGCCCTGGGAAGCAGG + Intronic
1153995275 18:10434743-10434765 GCAAGTCTGCTTTGGGAAGCAGG - Intergenic
1154297540 18:13163365-13163387 CTCAGCCTGCTCTGGGCAGAGGG + Intergenic
1156475048 18:37400642-37400664 CAAAGCCTGGTGTGGGAAGCTGG - Intronic
1156622003 18:38864039-38864061 CTGAGGCTGTGCTGGGAAGCAGG - Intergenic
1159330649 18:66990588-66990610 CTCATTCTGCTCTGGGATGAGGG - Intergenic
1159585736 18:70282095-70282117 ATAATTATGCTCTGGAAAGCAGG + Intergenic
1163726590 19:18926476-18926498 CTAAATCTGCTCACGGGAGCAGG - Intronic
1163820456 19:19493637-19493659 GTAAGTGTGTTCTGGGCAGCAGG + Intronic
1165236405 19:34425415-34425437 CTTAGTCTCCTCTGAGTAGCTGG + Intronic
1165314089 19:35044349-35044371 CTTGCTCTTCTCTGGGAAGCTGG + Intronic
1166204310 19:41259259-41259281 GCAAGTCTGTTCTGGGGAGCTGG + Intronic
1167555800 19:50194614-50194636 CTAAGTCAGCCCTGTGAGGCAGG - Intronic
1168366803 19:55795198-55795220 CTCTGTCTGCTCTGGGAAAGTGG - Intronic
926368931 2:12161276-12161298 TTAAGTCTCCTGTGGGAGGCAGG + Intergenic
926985047 2:18613345-18613367 CAAAGTCTGATGTGTGAAGCAGG - Intergenic
928420519 2:31134734-31134756 CCAAGGGAGCTCTGGGAAGCGGG + Intronic
929578707 2:43068499-43068521 CTAAGTCTGCACCCTGAAGCGGG - Intergenic
929821071 2:45274241-45274263 CAAAGGTTTCTCTGGGAAGCTGG - Intergenic
932605299 2:73161515-73161537 CTAAGTCAGCTTTGGGATGTTGG + Intergenic
934716751 2:96549192-96549214 CTAGGTGTTCTCTGGGAAACTGG + Intronic
934969287 2:98750074-98750096 CCAAGTCTGAACTAGGAAGCTGG + Intergenic
935944173 2:108270762-108270784 CTGAGTCTTCTGTCGGAAGCCGG - Intergenic
943979960 2:194536951-194536973 CAAAGTTTGCTCTGGCAATCTGG + Intergenic
945327731 2:208502049-208502071 CGAAGTGTGATCTGGGAAGGAGG + Intronic
946514982 2:220402179-220402201 CTAAGGCAGCTCAGGGCAGCAGG - Intergenic
948891046 2:240907308-240907330 CTAGGTGGGCTCTGGGAAGTAGG - Intergenic
1169909785 20:10637885-10637907 CTGAGTCTGTTCTGGTAATCGGG - Exonic
1173049555 20:39546178-39546200 ATTACTGTGCTCTGGGAAGCAGG + Intergenic
1173849855 20:46210818-46210840 CCAACACTGCGCTGGGAAGCAGG - Intronic
1174067509 20:47875837-47875859 GGAACTCTGCTGTGGGAAGCGGG - Intergenic
1174396466 20:50250033-50250055 TAAGGTCTGCTCTGGGAACCAGG - Intergenic
1175395042 20:58651770-58651792 CGAAGTCTGCCCTGGGTAGGGGG + Exonic
1175910719 20:62404296-62404318 CTCAATCTCCTCTGAGAAGCGGG - Intronic
1178378114 21:32085046-32085068 CTCAGTCTGGTCAGGGAAGATGG - Intergenic
1179397401 21:41054194-41054216 CTAAGTCAGGTCTGGGCTGCTGG - Intergenic
1182419227 22:30240820-30240842 CTATGTCTACTCTGGAGAGCCGG + Exonic
1182421938 22:30252817-30252839 CTCAGGCTGCCCTGGGAAGGTGG - Intergenic
1184471962 22:44701485-44701507 CTAAAAGTGCTCTGCGAAGCAGG + Intronic
1184648327 22:45908068-45908090 CCAATTCTGCCCTGGGCAGCGGG + Intergenic
949880839 3:8659451-8659473 CTCACTCTGCTCTGGGCAGGGGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
951825835 3:26867148-26867170 CTCAGCCTCCTCTGGAAAGCAGG - Intergenic
952735070 3:36681121-36681143 CCAAGGCTGCTCAGGGCAGCAGG + Intergenic
953075306 3:39564587-39564609 CGTTGTGTGCTCTGGGAAGCAGG + Intergenic
954943286 3:54394219-54394241 CTAAGGCCGCTCCGGGGAGCTGG - Intronic
959824470 3:110777493-110777515 CCATGTCTGCTCTGGGGAACTGG + Intergenic
960854252 3:122086583-122086605 CTAAATCCACGCTGGGAAGCTGG + Intronic
961555077 3:127691696-127691718 GTGAGTCTGCCCTGGGGAGCTGG + Exonic
961631659 3:128304487-128304509 CGAAGTCTGTTTTGGGAAGGTGG - Intronic
962237431 3:133718460-133718482 CTGTGTTTTCTCTGGGAAGCAGG + Intergenic
962415293 3:135176602-135176624 CAAAGTCTGCACTGTGAAGATGG - Intronic
964184393 3:153925081-153925103 CTATGTCTTCACTGGGATGCTGG + Intergenic
964645558 3:158955420-158955442 CTGAGTCTGTTCTGAGAAGGAGG - Intergenic
965672256 3:171158959-171158981 TTCACTCTGCTCTGGGAAGCCGG - Intronic
969248653 4:5953059-5953081 CTAGGTCTGCTGTGAGAGGCAGG + Intronic
974448506 4:62018392-62018414 CTGAGTCTCTTCTGGGAACCAGG - Intronic
977025356 4:91811997-91812019 CTAAGTTTGCTCTAGGAACCAGG - Intergenic
978365073 4:107972946-107972968 CTAAGTCTTCCCAGGGAAGGGGG - Intergenic
986136819 5:4987723-4987745 CTAATTCTGCTCTGGAGAACTGG + Intergenic
986331701 5:6721113-6721135 CTGAGTCTCCTCAGGGAAGGAGG + Intronic
986825872 5:11521993-11522015 TTAAGTTTGCTCTGTGAGGCTGG - Intronic
992895167 5:81239423-81239445 CTAAGTCTGCTCTGGGCTGAGGG + Intronic
995132726 5:108647523-108647545 CTGAGGCTGCTCAGGGAAGCAGG - Intergenic
996795797 5:127345370-127345392 CAAAGTCTGCTCTGTGGACCAGG - Intronic
997283862 5:132664787-132664809 CTAAGTCCTCCCTGGGGAGCCGG + Intergenic
997575900 5:134976958-134976980 CCAAGGCTGCTCAGGGCAGCAGG + Intronic
1001487019 5:172127205-172127227 CTATGTCTGCTTTTGGGAGCAGG - Intronic
1002268923 5:178056688-178056710 GGAACTCTGCCCTGGGAAGCCGG - Intergenic
1002295318 5:178227544-178227566 CTCAGTGTGCTCCGGGAACCAGG + Intronic
1002361133 5:178671881-178671903 CTAAGCCTGGCCTGGGAAGAAGG + Intergenic
1002640323 5:180627740-180627762 CTGAGCCTGCTCTGGGCAGGTGG - Intronic
1003133244 6:3413442-3413464 CCCAGCCTGCCCTGGGAAGCTGG - Intronic
1004492323 6:16128931-16128953 CTCAGCCGGCTCTGGGAGGCGGG + Intergenic
1005814330 6:29538660-29538682 CTCAGTGTTCTCTGGGAAGCTGG - Intergenic
1007836796 6:44680192-44680214 CACAGTCAGCTCTGGAAAGCTGG - Intergenic
1008475724 6:51933804-51933826 CTAAGTCTGCTCTTGCAAAGGGG + Intronic
1015184170 6:130394507-130394529 CACAGTCTGCTCTGGGGAGGTGG + Intronic
1015506130 6:133990859-133990881 CAAAGGCTGCTCTGTGAAGAAGG + Exonic
1017906257 6:158759168-158759190 CTGAGCCTGCTCTGGCAAGTGGG + Intronic
1018716891 6:166539989-166540011 CATAGTGTGCTCTGGGAACCAGG + Intronic
1022300462 7:29097906-29097928 CTAAGTCTGTTCTGGTGAGAGGG - Intronic
1022766118 7:33414092-33414114 CTCAGTCTCCTCTGGGAAGCTGG - Intronic
1024134241 7:46390348-46390370 CTGGGTTTGCTCTTGGAAGCTGG - Intergenic
1024353816 7:48394441-48394463 GGAAGTCTGCTCTGGTAAGATGG - Intronic
1024691000 7:51803182-51803204 CTAAGTCTGCATGGGCAAGCCGG - Intergenic
1026822597 7:73559429-73559451 TTAAATATGCTTTGGGAAGCTGG - Intergenic
1027267864 7:76504012-76504034 CTGAGTCTCCTCTGGGACTCTGG - Intronic
1027319675 7:77003874-77003896 CTGAGTCTCCTCTGGGACTCTGG - Intergenic
1031473788 7:122198658-122198680 GAATGTCTGCTCTGAGAAGCAGG + Intergenic
1031488750 7:122362244-122362266 CTACGTAAGCTTTGGGAAGCAGG - Intronic
1032573251 7:133024344-133024366 CACAGTCAGCTTTGGGAAGCAGG + Intronic
1032639889 7:133754220-133754242 CCAATTCTGCCCTGGGCAGCTGG + Intronic
1034228868 7:149503574-149503596 CTAAGTCTTGTCTGGGACTCAGG + Intergenic
1034390701 7:150785311-150785333 CTGAGTCTCCTCTGGGAGACAGG + Intergenic
1034978880 7:155463302-155463324 CCAGGCCTGCTCTGGGAAGTCGG + Exonic
1035555762 8:565928-565950 CTGAGTCTGCCCTGGGAAAGTGG + Intergenic
1040616120 8:49040734-49040756 CCATGTCTGATCTAGGAAGCAGG - Intergenic
1041141181 8:54820845-54820867 CTGAGTGTGTTCTGGGAAGGAGG - Intergenic
1045247793 8:100458685-100458707 CCACCTCTGCTCTGGGATGCTGG - Intergenic
1047140414 8:122132708-122132730 CTAGGTCTGCTCTAGGCAGTTGG - Intergenic
1048291438 8:133184661-133184683 CTAGGTCTACTCTGGGAGGCTGG - Intergenic
1049049433 8:140182858-140182880 GAAAGGCTGCACTGGGAAGCTGG - Intronic
1052297469 9:26913616-26913638 CTAATTCTGCTCTGAGATGGGGG - Intronic
1054981185 9:71208575-71208597 CTAAGTAAACTCTTGGAAGCTGG - Intronic
1055618805 9:78101596-78101618 ATAAGGCAGCTCTGGGGAGCAGG + Intergenic
1057024715 9:91726059-91726081 CTAAGGCTGCTCTGGGATGAGGG + Intronic
1059681684 9:116591764-116591786 CAAAGTGGGCTCTGTGAAGCTGG + Intronic
1060722130 9:125986410-125986432 CTCACTCTGGTCAGGGAAGCTGG + Intergenic
1061543134 9:131288983-131289005 CTGGGTCTGGTCTGGGAATCAGG - Intergenic
1186543591 X:10425939-10425961 CTGAGGTTGCTCTGGGAAGAGGG + Intergenic
1186568211 X:10686873-10686895 TGCAGGCTGCTCTGGGAAGCAGG + Intronic
1186797318 X:13059459-13059481 CAAGGACTGCTCTGGGAATCGGG - Intergenic
1189123469 X:38420560-38420582 CAATGTCTGCTCTCTGAAGCTGG - Intronic
1195521454 X:105834999-105835021 CTAAGTCATCTCTGAGAGGCTGG + Intronic
1195924141 X:110008761-110008783 CTCAGTCTTCTCTGTGAAACGGG + Intronic
1198167411 X:134071250-134071272 TCAATTCTGCTCTGAGAAGCAGG - Intergenic