ID: 1070335405

View in Genome Browser
Species Human (GRCh38)
Location 10:75450514-75450536
Sequence TATTAAACACAATTGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070335400_1070335405 6 Left 1070335400 10:75450485-75450507 CCAAACCATTCTTGAGATAAAGC 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1070335405 10:75450514-75450536 TATTAAACACAATTGGAGGGAGG No data
1070335401_1070335405 1 Left 1070335401 10:75450490-75450512 CCATTCTTGAGATAAAGCAAGAC 0: 1
1: 0
2: 0
3: 21
4: 240
Right 1070335405 10:75450514-75450536 TATTAAACACAATTGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070335405 Original CRISPR TATTAAACACAATTGGAGGG AGG Intronic
No off target data available for this crispr