ID: 1070336107

View in Genome Browser
Species Human (GRCh38)
Location 10:75456305-75456327
Sequence GTGCCTCTTCACACCCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070336104_1070336107 -1 Left 1070336104 10:75456283-75456305 CCAAGACTCCTGCCACAAGCATG 0: 1
1: 0
2: 1
3: 18
4: 178
Right 1070336107 10:75456305-75456327 GTGCCTCTTCACACCCAGCAAGG No data
1070336105_1070336107 -9 Left 1070336105 10:75456291-75456313 CCTGCCACAAGCATGTGCCTCTT 0: 1
1: 0
2: 0
3: 18
4: 178
Right 1070336107 10:75456305-75456327 GTGCCTCTTCACACCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070336107 Original CRISPR GTGCCTCTTCACACCCAGCA AGG Intronic
No off target data available for this crispr