ID: 1070339309

View in Genome Browser
Species Human (GRCh38)
Location 10:75482111-75482133
Sequence AGGAGTATACACTCTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070339309_1070339318 21 Left 1070339309 10:75482111-75482133 CCTCCCTCAGAGTGTATACTCCT 0: 1
1: 0
2: 0
3: 17
4: 128
Right 1070339318 10:75482155-75482177 TCACGGAACTTGCTCAGGCCAGG No data
1070339309_1070339312 -7 Left 1070339309 10:75482111-75482133 CCTCCCTCAGAGTGTATACTCCT 0: 1
1: 0
2: 0
3: 17
4: 128
Right 1070339312 10:75482127-75482149 TACTCCTGACCACTGATGTTAGG No data
1070339309_1070339316 4 Left 1070339309 10:75482111-75482133 CCTCCCTCAGAGTGTATACTCCT 0: 1
1: 0
2: 0
3: 17
4: 128
Right 1070339316 10:75482138-75482160 ACTGATGTTAGGCATGGTCACGG No data
1070339309_1070339319 22 Left 1070339309 10:75482111-75482133 CCTCCCTCAGAGTGTATACTCCT 0: 1
1: 0
2: 0
3: 17
4: 128
Right 1070339319 10:75482156-75482178 CACGGAACTTGCTCAGGCCAGGG No data
1070339309_1070339317 16 Left 1070339309 10:75482111-75482133 CCTCCCTCAGAGTGTATACTCCT 0: 1
1: 0
2: 0
3: 17
4: 128
Right 1070339317 10:75482150-75482172 CATGGTCACGGAACTTGCTCAGG No data
1070339309_1070339314 -2 Left 1070339309 10:75482111-75482133 CCTCCCTCAGAGTGTATACTCCT 0: 1
1: 0
2: 0
3: 17
4: 128
Right 1070339314 10:75482132-75482154 CTGACCACTGATGTTAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070339309 Original CRISPR AGGAGTATACACTCTGAGGG AGG (reversed) Intronic
901248392 1:7752310-7752332 AGATGTATACAATCTGAAGGGGG - Intronic
902143251 1:14374694-14374716 AGGAATCTACATTCTGAGAGTGG - Intergenic
904703900 1:32376340-32376362 CAGAGTAGAGACTCTGAGGGAGG - Exonic
905862480 1:41360989-41361011 AGGAGTCTACAAACAGAGGGCGG + Intergenic
907372379 1:54011732-54011754 AGGAGTTCACAGTCTGATGGGGG + Intronic
907702016 1:56797886-56797908 AAGAGTTTACATTCTGATGGAGG - Intronic
912900926 1:113647417-113647439 AGGTGTATGCAATTTGAGGGAGG + Intronic
916500108 1:165379852-165379874 AGGAGTTTGCAGTCTGATGGAGG - Intergenic
917554370 1:176068388-176068410 AGGATTAGAAACTCTGAGAGTGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
922364933 1:224854604-224854626 AGGAGTCTAACCCCTGAGGGAGG + Intergenic
923256172 1:232223441-232223463 AGAAATAGGCACTCTGAGGGAGG - Intergenic
923481490 1:234389445-234389467 GGGAGTGTAAACTCTGTGGGAGG - Intergenic
924568591 1:245218334-245218356 AGCAGTTGTCACTCTGAGGGAGG + Intronic
924582632 1:245335472-245335494 AGGAGTCTGGACTGTGAGGGAGG + Intronic
1062957022 10:1547185-1547207 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957050 10:1547334-1547356 AGGTGTATACACTGTGGGGAGGG + Intronic
1062957144 10:1547809-1547831 AGGTGTATACACTGTGGGGAGGG + Intronic
1063376022 10:5554833-5554855 AGGACTATGCATTCTGAGAGAGG - Intergenic
1064872303 10:19951983-19952005 AGGAGACTACACGGTGAGGGGGG + Intronic
1066627394 10:37421176-37421198 AGGAGAATACCCTCAGATGGGGG - Intergenic
1069784561 10:70979448-70979470 TGGAGCTTACCCTCTGAGGGAGG - Intergenic
1070339309 10:75482111-75482133 AGGAGTATACACTCTGAGGGAGG - Intronic
1070758456 10:79008185-79008207 AGGAGTAAACAGACTCAGGGTGG - Intergenic
1071547095 10:86537106-86537128 AGGAGTACACAGCCTGAGGCTGG - Intergenic
1073702496 10:105944210-105944232 AGGGGTATCCACTCTGTGAGAGG + Intergenic
1080748041 11:35126703-35126725 AGGAGCTGACACTCTGTGGGTGG + Intergenic
1084105576 11:66978136-66978158 AGGAGAATACAGGCTGAGGCAGG - Intergenic
1084610609 11:70200376-70200398 AGGACTACTCTCTCTGAGGGAGG + Intergenic
1088701098 11:112412498-112412520 TGGAGTACACAGTCTGATGGGGG - Intergenic
1089167922 11:116491696-116491718 AGGAGTTTATACTCTGAAAGAGG - Intergenic
1094268091 12:28581285-28581307 ACGAGTTTACACTCTGGCGGGGG - Intergenic
1096590606 12:52656618-52656640 AGAAGTCTGCACTGTGAGGGTGG - Intergenic
1098834839 12:75411119-75411141 TGGAGTATAAAGTGTGAGGGTGG - Intronic
1101645438 12:106627077-106627099 AGAAGTGTACACTCAGAGTGAGG - Intronic
1101791067 12:107928238-107928260 AGGAGTTTACACTCTGCTGGCGG - Intergenic
1104334254 12:127878576-127878598 GGGAGTAGACACCCTGAGGCAGG + Intergenic
1104548045 12:129730383-129730405 AGGGGTATGCTCCCTGAGGGTGG + Intronic
1109850825 13:68061198-68061220 TGCAGTAGACACTCTGATGGAGG + Intergenic
1110587994 13:77217386-77217408 AGGCGGATAGACTCAGAGGGTGG + Intronic
1112320765 13:98405455-98405477 AGGTGTTTTCAGTCTGAGGGGGG + Intronic
1112431967 13:99358134-99358156 AGGAGTAGAGAATGTGAGGGCGG + Intronic
1114817452 14:25977323-25977345 AGGAAAATGCACTCTGAGGGTGG + Intergenic
1115672640 14:35631592-35631614 AGAAGTTTACACTCTGAAGAAGG + Intronic
1116990272 14:51268630-51268652 AGGAGTATATACTTTGATGAGGG + Intergenic
1118534618 14:66746860-66746882 AGGAGTCAAAACTCTGAGGGAGG - Intronic
1120293791 14:82612149-82612171 ATGAGTATACACTCATAGGAAGG + Intergenic
1120823314 14:88932845-88932867 AGAAGCAGACACTCTGAGGGTGG - Intergenic
1120949984 14:90031995-90032017 TGGAGTATACAGTCTGGTGGAGG - Intronic
1122409410 14:101518314-101518336 AGCAGTACACACTGGGAGGGAGG + Intergenic
1122683031 14:103481158-103481180 AGGTGTAGAGACTCTGAGGTGGG + Intronic
1128345316 15:66849419-66849441 AGGAGTCTCCAGTCTGATGGAGG - Intergenic
1130155035 15:81343000-81343022 AGTAGAATACACTCTTAGGGAGG - Intronic
1133831280 16:9325826-9325848 ATGAGTAAACACCCTGTGGGTGG + Intergenic
1134060177 16:11194846-11194868 AGGAGAATAGATCCTGAGGGGGG - Intergenic
1139952044 16:70677261-70677283 AGGAGTAAACAAACTCAGGGAGG - Intronic
1143418700 17:6771637-6771659 AGGAGTATACAATTAGAAGGTGG + Intronic
1147138324 17:38447677-38447699 AGGAGCACACAGTCTGATGGAGG + Intronic
1147670025 17:42171517-42171539 CGCAGGAAACACTCTGAGGGTGG - Intronic
1148468995 17:47881909-47881931 AGGAGCTTTCAGTCTGAGGGAGG + Intergenic
1148479129 17:47948704-47948726 AGGATCATAGACTGTGAGGGTGG - Intergenic
1157748908 18:50160996-50161018 AGGAGGACACAAGCTGAGGGTGG - Intronic
1158253503 18:55517395-55517417 ATGAGGATACAGTCTGATGGCGG - Intronic
1158929649 18:62311032-62311054 AGGAGCAAGCACTTTGAGGGAGG - Intergenic
1161383643 19:3979763-3979785 GGGAGCAGACACCCTGAGGGGGG - Intronic
1162189140 19:8931060-8931082 AGGTGCAAAGACTCTGAGGGTGG + Intronic
1163127394 19:15251635-15251657 AGGACTCTGCACTCTCAGGGCGG - Intronic
1167814821 19:51870463-51870485 AGGAGTATTGCCTCTGTGGGTGG - Intronic
1168415206 19:56163363-56163385 AGGACTGTGCACTCTGAGGAAGG - Intergenic
926698328 2:15785834-15785856 GGGAGTATGTACTCTGAGGGTGG - Intergenic
927497003 2:23557733-23557755 AGGAGGGTACGCACTGAGGGCGG - Intronic
927879509 2:26680791-26680813 AGGACAATAAGCTCTGAGGGAGG + Intergenic
928189654 2:29151556-29151578 AGTAGTATGGACTCTGAGGTGGG + Intronic
930669219 2:54130531-54130553 TGGAGAATACACTGTAAGGGGGG + Intronic
935173482 2:100628624-100628646 AGCCGAATCCACTCTGAGGGTGG - Intergenic
935501017 2:103838837-103838859 TGGAGGACACACGCTGAGGGGGG + Intergenic
935530930 2:104231702-104231724 AGGAGTGTGCACACAGAGGGAGG - Intergenic
936703618 2:115042831-115042853 ACAAGTATACACTATGAGGTGGG - Intronic
936987325 2:118323880-118323902 AGGAGCTTACACTCAGAGTGGGG + Intergenic
943607236 2:189990480-189990502 AGGACTATACACTCTGACCAAGG - Intronic
944846678 2:203675566-203675588 TGGAGTGTACAGTCTGATGGAGG + Intergenic
945489934 2:210442956-210442978 GGGAGCCTAAACTCTGAGGGAGG + Intronic
1170549791 20:17467083-17467105 AGGAGGATAAAGTCTGAGAGGGG - Intronic
1172609266 20:36237352-36237374 AGGAGCAAGCACTCTGAGTGAGG + Intronic
1173677373 20:44848558-44848580 AGGACTATACTCTCTAAGGGAGG - Intergenic
1177037477 21:16061171-16061193 AGGCGTGTACACGCTTAGGGCGG - Intergenic
1177423447 21:20892174-20892196 TGGAGTATAAACTGTGAGGTGGG - Intergenic
1178631063 21:34261827-34261849 AGGAGGACAGACTCTGAGGCAGG + Intergenic
1182925583 22:34121026-34121048 AGGAGCCAACATTCTGAGGGAGG - Intergenic
1185290197 22:50020911-50020933 AGGAGTACACATTCAGATGGAGG - Intronic
949455532 3:4234427-4234449 AGCATTATAAAGTCTGAGGGAGG - Intronic
951228813 3:20152435-20152457 TGTAGTATTCACTCTCAGGGGGG - Exonic
953058144 3:39404787-39404809 AGCAGTGAACACTCAGAGGGTGG + Intergenic
955509120 3:59661811-59661833 AGGTGCTTACACTCTGAAGGGGG + Intergenic
962254434 3:133860740-133860762 AGGAGGACACACTCTCAGAGTGG - Intronic
964468312 3:157023193-157023215 AGGATTATAAACTCTAAGAGAGG - Intronic
965308696 3:167101035-167101057 AGGAGTATACAGTGTGTGTGTGG + Intergenic
966603400 3:181797575-181797597 AGGAATATACACTTTGAGAGTGG + Intergenic
967656802 3:192060396-192060418 ACGAGTGTTCAGTCTGAGGGAGG - Intergenic
971630349 4:28984947-28984969 AGTATTATACACTTTGATGGAGG - Intergenic
972183270 4:36495735-36495757 AGGAGAATTGACTCGGAGGGTGG + Intergenic
978889587 4:113807897-113807919 AGGAGTATATTCTCTGAGGAAGG + Intergenic
979890122 4:126081896-126081918 AGGGGCAAACACTCTGAGGCAGG + Intergenic
981129883 4:141146803-141146825 AGAAGTATACAATCTGCTGGAGG + Intronic
982173142 4:152680726-152680748 AGGAGAATATGCTCTGAGGGTGG + Intergenic
983280053 4:165669092-165669114 AGGAGTCTACACTGAAAGGGTGG - Intergenic
984254355 4:177373182-177373204 AGGAGTTTACAGTCTTTGGGGGG + Intergenic
988485460 5:31665016-31665038 AGGAGTCTACACTATGAAGGGGG + Intronic
990356581 5:54973411-54973433 AGGAGTCCACACTCTGATTGTGG + Intergenic
991260814 5:64665879-64665901 AGTAGTAGACACTCTTTGGGAGG + Intergenic
992877200 5:81068716-81068738 AGAAGTTCACACTCTGAGGGAGG - Intronic
994196732 5:96930504-96930526 AGAAACAGACACTCTGAGGGAGG - Intronic
995086294 5:108114163-108114185 TGGAGTATAAACTCTTCGGGAGG - Intronic
998113015 5:139516602-139516624 AGGAGTTTACATTCTGACTGGGG + Intergenic
999044161 5:148449562-148449584 AAGAGAATCCACTCTGAGGAGGG + Intergenic
1003914313 6:10771320-10771342 AAGAGAATACACACTGAGTGTGG + Intronic
1004401951 6:15296971-15296993 AGGAGGGGACACTCTGAGGATGG - Intronic
1005591036 6:27327558-27327580 AGAAGGAGACACTTTGAGGGAGG - Intergenic
1005664950 6:28043023-28043045 AGGATTATTCTCTCTGAGGGTGG + Intergenic
1006093826 6:31643851-31643873 AGGAGTTTAAACTCTGAGTGGGG + Intronic
1008002046 6:46370823-46370845 AGGAGTATACACTATGCAGTGGG - Intronic
1010534833 6:77013669-77013691 CTGAGCATACACTCTGAGGCTGG - Intergenic
1011475198 6:87744686-87744708 AGGATTATCCAGGCTGAGGGTGG - Intergenic
1011786794 6:90855675-90855697 AGGATCAGAAACTCTGAGGGTGG - Intergenic
1013545280 6:111150734-111150756 AGGAGTAGACACTGAGGGGGTGG + Intronic
1015950604 6:138548969-138548991 ATAAGTTCACACTCTGAGGGTGG - Intronic
1018227948 6:161647565-161647587 AGGAATATACTCTCTGAGTATGG - Intronic
1021580133 7:22143619-22143641 AAGAGTACACTCTCTGTGGGAGG - Intronic
1023337681 7:39187234-39187256 AGGAGCACAGGCTCTGAGGGCGG - Intronic
1037561245 8:20076428-20076450 AGGAGCTTACATTCTGATGGGGG - Intergenic
1043643492 8:82486767-82486789 AGGAGTATGCAGTCTAATGGAGG - Intergenic
1046295416 8:112213550-112213572 ACAGATATACACTCTGAGGGGGG + Intergenic
1048459865 8:134612458-134612480 AGGAGTATTCTTTCTTAGGGAGG + Intronic
1051912822 9:22173993-22174015 AGGAGTTTACAGTCTCATGGGGG + Intergenic
1052478916 9:28996519-28996541 AGGAGTATAGATTCTGGGGCAGG + Intergenic
1053174908 9:35915707-35915729 AGAAGTTTACTCTATGAGGGAGG - Intergenic
1054846768 9:69806783-69806805 AGGAGTATATAATCTGTGAGGGG - Intergenic
1059294504 9:113257782-113257804 ATAAGTAAACACTCTGAGGCCGG - Intronic
1061005614 9:127927311-127927333 AGGAGTGCACAGTCTGCGGGTGG - Exonic
1187529579 X:20084299-20084321 AGGTGTATACACTGTGAAGAAGG - Intronic
1190159365 X:48019583-48019605 AGGAATATACAATCTGAAAGGGG - Intronic
1190175077 X:48141816-48141838 AGGAATATACAATCTGAAAGGGG - Intergenic
1192596079 X:72409825-72409847 AGGAGCTTACAGTCTGATGGAGG - Intronic
1194777001 X:97977464-97977486 ACAAGTATACACACTGAGGGCGG - Intergenic
1196948721 X:120854330-120854352 TGGAGTATACATTCTTAGGTAGG + Intergenic