ID: 1070342184

View in Genome Browser
Species Human (GRCh38)
Location 10:75507821-75507843
Sequence CTTCTGTGCCTAAGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070342184_1070342187 -5 Left 1070342184 10:75507821-75507843 CCATTTGTCCTTAGGCACAGAAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1070342187 10:75507839-75507861 AGAAGGTTCCCTTTAATTAGCGG No data
1070342184_1070342191 26 Left 1070342184 10:75507821-75507843 CCATTTGTCCTTAGGCACAGAAG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1070342191 10:75507870-75507892 CTATTTCCCTTTTCTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070342184 Original CRISPR CTTCTGTGCCTAAGGACAAA TGG (reversed) Intronic
904008781 1:27378274-27378296 CTTCGGTGCCTGGGGACAGAAGG + Intergenic
904741861 1:32683589-32683611 CTTGTGTGCCTAATGACAAGGGG - Exonic
907160217 1:52364215-52364237 CTTCACTGCCTAGGGACAGATGG - Intronic
912084755 1:105985369-105985391 CTTCTGAGGCTGTGGACAAAAGG + Intergenic
917798829 1:178552295-178552317 TTACTATGCCTAAGGACAGAGGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921568030 1:216744194-216744216 CCTCTGTGCCTCTGAACAAACGG + Intronic
922824525 1:228508482-228508504 CTACTGTGTCTGAGGACACATGG + Intergenic
1064137277 10:12761962-12761984 CTTCTGTGCCAACGGGGAAAGGG - Intronic
1065303842 10:24350155-24350177 CTTCTATGCCTCAAGCCAAAAGG - Intronic
1066022312 10:31316845-31316867 TATCTGTTCCTAAGGACTAAAGG + Intergenic
1067575963 10:47408884-47408906 CTTCTGTTCCTGGGAACAAAAGG + Intergenic
1070025064 10:72624630-72624652 CTTGTGTGCCTGAGGAGAAAGGG - Intronic
1070342184 10:75507821-75507843 CTTCTGTGCCTAAGGACAAATGG - Intronic
1070629153 10:78072150-78072172 CTTCTTTTCCCAGGGACAAAAGG + Intergenic
1070780297 10:79133678-79133700 CTTCAGTGCCCAAGGAATAAGGG - Intronic
1072642636 10:97223741-97223763 CTTCTGTGGCAAATGATAAAAGG + Exonic
1072746797 10:97945786-97945808 CATCTGCCCCTTAGGACAAAAGG - Intronic
1073353896 10:102838399-102838421 CTTCTGAGGGAAAGGACAAAGGG + Intergenic
1076001473 10:126916563-126916585 TTTCTGTGGCTTAGGACAGAAGG - Intronic
1077804821 11:5580031-5580053 CATCTGTGCCTAGGGAAAAATGG + Intronic
1079766176 11:24395998-24396020 CTTCTGTGGCAAAGGTAAAAAGG + Intergenic
1086530599 11:87780351-87780373 CTTCTGTGCCTAGTGATCAATGG - Intergenic
1086576598 11:88345578-88345600 CCTCTTTGCCTTATGACAAAGGG - Intergenic
1088133672 11:106527249-106527271 CTCTTTGGCCTAAGGACAAAAGG - Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089701147 11:120244772-120244794 CTTCTGTTCCAATGGAGAAACGG - Intronic
1089917153 11:122169048-122169070 CTTCTGTATCTGAAGACAAAAGG - Intergenic
1095851833 12:46817634-46817656 CTTCTAAGCCTTTGGACAAAAGG + Intronic
1096227197 12:49873728-49873750 CATCTGTGGCTATGGACCAAGGG - Intronic
1096463247 12:51834422-51834444 CTTCTGTGGGAGAGGACAAAAGG + Intergenic
1101475819 12:105047245-105047267 ATTCTGTTACTAAGGACAGAGGG - Intronic
1102347631 12:112169819-112169841 CTTCTGTGCCTTAGCACTCATGG + Intronic
1102560910 12:113761851-113761873 CTTCTGGTCCTAAGGAAAATGGG - Intergenic
1104166630 12:126237412-126237434 TTTCTGTGGCTCAGAACAAATGG + Intergenic
1104179713 12:126367318-126367340 CTTCTGTGTCTAGAGACCAAGGG + Intergenic
1105713313 13:23034235-23034257 AGTCTGTGACTATGGACAAAGGG + Intergenic
1105767586 13:23577308-23577330 CTACTGTCTCTAAGGACAAAAGG + Intronic
1108451804 13:50574752-50574774 CTTCTCTGCCTGAGGAAGAAAGG - Intronic
1109116047 13:58387107-58387129 TTACTGTGCTTAAGTACAAATGG + Intergenic
1110964669 13:81677828-81677850 CTACTGTGGCAAAGGAAAAATGG + Intergenic
1114911492 14:27204531-27204553 CTTCTGTCCCTGAGAACAAGTGG + Intergenic
1117834874 14:59793415-59793437 CTTCTGTACTTAAGAAAAAAAGG - Intronic
1117860342 14:60085003-60085025 GTTCTGTGCATCAGGAGAAATGG + Intergenic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1124551903 15:30688901-30688923 AATCTGTGCATATGGACAAAGGG - Intronic
1124606087 15:31171302-31171324 CTGCTGTGACTAAGGACCACAGG + Intergenic
1124679344 15:31716770-31716792 AATCTGTGCATACGGACAAAGGG + Intronic
1126491498 15:49241909-49241931 CTGCAGTGCCTAAGCAAAAAGGG + Intronic
1127849691 15:62901891-62901913 TTCCTGTGCCTAAGGACCCACGG + Intergenic
1129119481 15:73387298-73387320 CATCTGTACCCAAGGCCAAATGG + Intergenic
1129120873 15:73395772-73395794 CTTCAGTTCCTAATGAGAAATGG + Intergenic
1129145263 15:73641359-73641381 GTTCTGACCCAAAGGACAAATGG - Intergenic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1131257037 15:90869815-90869837 CTTCTAGGCCTGAGGACAAGTGG + Intronic
1131638507 15:94263572-94263594 CTGGTGTTCCTAAGGACAGAAGG - Intronic
1132712857 16:1277014-1277036 CTCCTGTGGCTGAGGATAAAGGG - Intergenic
1138806048 16:60090030-60090052 TTTCTGTGCTAAAAGACAAATGG - Intergenic
1138836577 16:60443972-60443994 CTTCTGTGCCCAAGGAAGAAAGG - Intergenic
1140731487 16:77860518-77860540 CCTATTTGCCTAAGGACAGAGGG + Intronic
1144275802 17:13667077-13667099 CTGCTGTGCCTGAGGTCAGATGG - Intergenic
1145083694 17:19917337-19917359 CTTCTGTCCATAAGGATAATGGG - Intronic
1145275727 17:21428931-21428953 GTTCTGTGCCAAAGGACATTGGG - Intergenic
1145313575 17:21714839-21714861 GTTCTGTGCCAAAGGACATTGGG - Intergenic
1145712019 17:26986816-26986838 GTTCTGTGCCAAAGGACATTCGG - Intergenic
1146805689 17:35863429-35863451 CTCCTTTGGGTAAGGACAAATGG - Intronic
1149968813 17:61195177-61195199 CTTCTGGGCATAAGCACAATTGG - Intronic
1155806628 18:30178336-30178358 CACCTCTGCCTAAGGACATAGGG + Intergenic
1156611734 18:38732840-38732862 CTTCTTTGCCACTGGACAAAGGG - Intergenic
1157697739 18:49736708-49736730 CTTCTGTGCCTCAGGTGAAACGG - Intergenic
1158271873 18:55725473-55725495 GTTCTGATCCTAAGGACAATGGG - Intergenic
1158498431 18:57978226-57978248 GTTTTGAGCCTAAGGAAAAAAGG + Intergenic
1163095813 19:15056176-15056198 CTTCTGTTCCCAAGGCCAAATGG + Exonic
1164519361 19:28966706-28966728 CTTCTGTGCCCAGGGTCAACTGG + Intergenic
1165462848 19:35954222-35954244 CTTCTGTGCCTGAGGAAGGAGGG - Intergenic
1165798526 19:38533150-38533172 CTTCTGAGCAGAAGGATAAAAGG + Intronic
1167382978 19:49149289-49149311 TGTCTGTGCCTAAGGAGATAAGG - Exonic
926786161 2:16520490-16520512 CTTCTGTGTCTAATGGCAGATGG - Intergenic
927072399 2:19544514-19544536 CTTCTGACTCTAAGGAAAAAGGG + Intergenic
927317896 2:21706881-21706903 CTTTTTTACCTAAGGACAAATGG - Intergenic
928214989 2:29353974-29353996 CTCTTGTGCTTAAGGACCAAAGG - Intronic
932188102 2:69715743-69715765 CTTCTGTGCCTATGCACAGAGGG + Intronic
933569691 2:83994935-83994957 ATTCACTGCCTGAGGACAAAAGG + Intergenic
937344175 2:121113292-121113314 ATTCTGTGGCTTTGGACAAATGG - Intergenic
941888214 2:170551607-170551629 CTTGTGGGCATGAGGACAAAGGG + Intronic
942618007 2:177814690-177814712 TTTTTGTGTCTAAGGACAGAGGG + Intronic
942754568 2:179324872-179324894 CTTCTGTTCCCAAAGGCAAAGGG - Intergenic
942897336 2:181073023-181073045 CTTCTGTGCCTAAGAGCATTTGG + Intronic
944282033 2:197909340-197909362 CTTCTGTTCCTTAGCAAAAAAGG - Intronic
944744261 2:202639437-202639459 CCTCAGTTCCTAATGACAAACGG - Intronic
947340073 2:229129092-229129114 GTTGTGTGCCTCAGGGCAAATGG - Intronic
947862381 2:233369863-233369885 CTTCTGTGTCTGAGGGTAAAGGG + Intronic
1169764300 20:9132175-9132197 GGTCTGTGCAAAAGGACAAAGGG + Intronic
1170243009 20:14191204-14191226 CTTCTGTGTCTGAGGGCAACAGG - Intronic
1170737154 20:19022148-19022170 CCTCTGTGGCTAAGGAGAGATGG - Intergenic
1170870339 20:20200152-20200174 CTGCTGTGTCCCAGGACAAAAGG + Intronic
1171211766 20:23322263-23322285 GTTCTGTTCCTAAGGAAAAAGGG + Intergenic
1171248363 20:23631420-23631442 CTTCTGTGCCATAGGGGAAAAGG - Intronic
1173081434 20:39871814-39871836 ATTCTTTGCCTAATGACACATGG + Intergenic
1175665153 20:60852397-60852419 CTTCTAAGACTAAGGCCAAAGGG - Intergenic
1179974730 21:44858151-44858173 CATCTTTGCCTCTGGACAAACGG + Intronic
1182812297 22:33127305-33127327 CTTCTCTTCCTAAGCACAAGTGG + Intergenic
1184920497 22:47602017-47602039 CTTCTCTGCCAAAGACCAAACGG - Intergenic
1185033671 22:48459512-48459534 CTGCTGGACCTTAGGACAAATGG - Intergenic
1185239269 22:49733930-49733952 GTTGTGTGCCTAAGCACAACAGG - Intergenic
952426201 3:33176871-33176893 CATCTTTGACTAAGGAGAAAAGG - Intronic
953253127 3:41264406-41264428 CTTCTGCCACTGAGGACAAAGGG - Intronic
953480420 3:43246720-43246742 CTTCTCTGCATAAGGCCAAGAGG - Intergenic
954605044 3:51902996-51903018 ACTCTGCTCCTAAGGACAAATGG + Exonic
961012687 3:123447068-123447090 CTTCTGTTCCTATATACAAAAGG - Intronic
961430759 3:126881256-126881278 GTTCAGTGCCTAAGGCCACAGGG - Intronic
961520950 3:127467150-127467172 CCTCTGTGCCTGAAGACAAGGGG - Intergenic
962174216 3:133135911-133135933 TTTATGTGCTTCAGGACAAATGG + Intronic
962243115 3:133768009-133768031 CATCTGTGCAGAAGGACAAGAGG - Exonic
962343594 3:134604369-134604391 CTGCTGAGCCTAAGGAAGAATGG - Exonic
964032022 3:152149126-152149148 CTTCTGTTCATAAGGATGAAAGG - Intergenic
964112318 3:153100313-153100335 AACCAGTGCCTAAGGACAAAAGG - Intergenic
966276335 3:178174966-178174988 GTTCTTTGCCAAAGGACAGAGGG - Intergenic
967986073 3:195096154-195096176 CTTTTCTGCTTAAGGTCAAAGGG - Intronic
970014360 4:11496615-11496637 TTTGTGTGTCTAAGCACAAAGGG + Intergenic
972190411 4:36584673-36584695 CTTCTGTGGCAAAGGAGATAAGG - Intergenic
974027530 4:56746782-56746804 CTTCTGGGGCTAAGGAGGAATGG - Intergenic
976320035 4:83703585-83703607 TTTCTGTGAATAAGGCCAAAGGG + Intergenic
977712441 4:100143033-100143055 CATATGGGCCTAAGAACAAATGG - Intergenic
978956292 4:114616890-114616912 CTTCTGTGCCTAGGTATCAATGG - Intronic
981111431 4:140938806-140938828 CTCCTGTCCCCAAGGACAGATGG - Intronic
987410034 5:17605371-17605393 GTTCTAGGCCTAAGGACAGAGGG + Intergenic
987448887 5:18056544-18056566 CTTCTTTGACTAAGGAGAAAGGG + Intergenic
989666763 5:43863533-43863555 CTTATGTGGATAAGGCCAAATGG + Intergenic
994247017 5:97489448-97489470 CTTCTGTGCCTATGGGGACAGGG + Intergenic
994614819 5:102091084-102091106 CCTCTCTGCCTGAGGACAGATGG - Intergenic
995926938 5:117386056-117386078 CTTCTGAGCCTAATGAGACAGGG - Intergenic
997742666 5:136270826-136270848 CTTCTGTTCCCAAGTCCAAAAGG - Intronic
997924592 5:138017617-138017639 CTTCTGTTCCTAGAGCCAAATGG - Intronic
998579031 5:143350656-143350678 GTCCTTTGCATAAGGACAAATGG + Intronic
1000048522 5:157541696-157541718 CTTCTGAGCCTTAGGAAAGACGG - Intronic
1000960381 5:167594240-167594262 CTTCTATGGCTAAAGACAGAAGG - Intronic
1001774263 5:174316815-174316837 CTTCTGTGCCAAATGAGGAAGGG + Intergenic
1003334279 6:5155903-5155925 CTCCTATGGCTAAGGACAACAGG + Intronic
1003998960 6:11575417-11575439 CTGCTGCACCTAAGGAGAAACGG - Exonic
1006951795 6:37828615-37828637 TTTCTGTGCCTAAGGAGGCATGG + Intronic
1008299557 6:49818437-49818459 CTTTTCTTCCTTAGGACAAATGG - Intergenic
1010291895 6:74147221-74147243 CATCTGTGACTAAGGTCAATGGG - Intergenic
1015334326 6:132020173-132020195 CTTCTGTGTCTGAGGACACACGG - Intergenic
1016525557 6:144998149-144998171 CTTCTGAGCTTAAAGAAAAAAGG + Intergenic
1020042422 7:5014157-5014179 CTTCTTTGCCTATGCACAGAGGG + Intronic
1020913703 7:14165955-14165977 CTTGTTTGCCTAAGGATAAAAGG - Intronic
1020962770 7:14826657-14826679 TTTATTTGCCTAAGGTCAAAGGG - Intronic
1023286842 7:38629987-38630009 CCTCTGGGCCTGGGGACAAAAGG + Intronic
1023665862 7:42522651-42522673 CTTTTGAAACTAAGGACAAAAGG - Intergenic
1027623444 7:80520736-80520758 CTTGTGTCCCTAAGGTCACAAGG - Intronic
1028356154 7:89912290-89912312 CTTCTGTGTTTCAGGACACAAGG + Intergenic
1030060613 7:105618089-105618111 TTTCTGTGCCTGAGGAGGAAAGG + Intronic
1030197996 7:106871528-106871550 CTTCCGTTCCTTAGGAAAAAAGG + Intronic
1031077933 7:117230849-117230871 CTCCAGTGCCTAAAAACAAAGGG + Intergenic
1031448857 7:121889298-121889320 CTTCTGTGCAAAAGCAGAAAGGG + Intronic
1032303309 7:130709624-130709646 CTTCTTAGCCAAAGGACAACTGG - Intergenic
1034707978 7:153163520-153163542 CTGCTGTGCATATGGACCAATGG + Intergenic
1035075588 7:156175283-156175305 CTTCTGTGCCTCCGCACCAATGG + Intergenic
1035611707 8:970435-970457 CACCAGTGCTTAAGGACAAATGG + Intergenic
1035948141 8:3988052-3988074 CTACTGTGCCTAAAAACATAGGG + Intronic
1037938735 8:22933192-22933214 CTGCTTTGCCTAAGGGAAAAGGG + Intronic
1038533555 8:28337976-28337998 GTTCTGTGCATAAGGAGAAGGGG + Intronic
1040855283 8:51942759-51942781 CTTCTGTGCTTTGGGAGAAATGG + Intergenic
1052047122 9:23806970-23806992 CTTCTGCACCTAAGGAAAAGGGG + Intronic
1054735831 9:68749023-68749045 GTCATGTGCCCAAGGACAAATGG - Intronic
1055564998 9:77559422-77559444 CTTCTGGGCCAGAGGACATAGGG + Intronic
1055663282 9:78528639-78528661 ACTTTCTGCCTAAGGACAAAGGG - Intergenic
1056091399 9:83208996-83209018 CTTCTGTGCCTCAGGGACAAAGG + Intergenic
1056233505 9:84569962-84569984 CTTCACTGCCTAAGGAGCAAGGG + Intergenic
1060029573 9:120202756-120202778 ATTCTGTCCCAAAGAACAAAGGG - Intergenic
1061952971 9:133946405-133946427 CTTCTGGGCCTCAGGAGAACAGG + Intronic
1062445384 9:136591719-136591741 CTTGTGTGCCAGAGGACAGACGG + Intergenic
1187394570 X:18908200-18908222 CTTCTGTTTCAAAGGACATAGGG - Intronic
1188001100 X:24982787-24982809 CTACTATGACTAAGGACAGATGG + Intronic
1189463874 X:41263583-41263605 CTTCAGGAACTAAGGACAAAAGG + Intergenic
1191891009 X:65940874-65940896 CTTCTGTGCATGTGGAGAAAGGG + Intergenic
1194821825 X:98517737-98517759 CTTTTGTTCATAACGACAAAGGG + Intergenic
1199046288 X:143177819-143177841 CAACTGTGGCTAAGGAAAAAGGG - Intergenic