ID: 1070350165

View in Genome Browser
Species Human (GRCh38)
Location 10:75583993-75584015
Sequence AGGGACTGTCCTTCCTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070350156_1070350165 -9 Left 1070350156 10:75583979-75584001 CCCAGCCCCCCCATAGGGACTGT No data
Right 1070350165 10:75583993-75584015 AGGGACTGTCCTTCCTCTCTGGG No data
1070350153_1070350165 -4 Left 1070350153 10:75583974-75583996 CCCTTCCCAGCCCCCCCATAGGG 0: 1
1: 0
2: 1
3: 19
4: 262
Right 1070350165 10:75583993-75584015 AGGGACTGTCCTTCCTCTCTGGG No data
1070350149_1070350165 25 Left 1070350149 10:75583945-75583967 CCTTGATGACAGACTTGATGTGG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1070350165 10:75583993-75584015 AGGGACTGTCCTTCCTCTCTGGG No data
1070350151_1070350165 -3 Left 1070350151 10:75583973-75583995 CCCCTTCCCAGCCCCCCCATAGG 0: 1
1: 0
2: 3
3: 40
4: 430
Right 1070350165 10:75583993-75584015 AGGGACTGTCCTTCCTCTCTGGG No data
1070350155_1070350165 -5 Left 1070350155 10:75583975-75583997 CCTTCCCAGCCCCCCCATAGGGA 0: 1
1: 0
2: 0
3: 15
4: 280
Right 1070350165 10:75583993-75584015 AGGGACTGTCCTTCCTCTCTGGG No data
1070350157_1070350165 -10 Left 1070350157 10:75583980-75584002 CCAGCCCCCCCATAGGGACTGTC 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1070350165 10:75583993-75584015 AGGGACTGTCCTTCCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070350165 Original CRISPR AGGGACTGTCCTTCCTCTCT GGG Intronic
No off target data available for this crispr