ID: 1070351696

View in Genome Browser
Species Human (GRCh38)
Location 10:75598926-75598948
Sequence TCATACAACTGATTAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070351696_1070351699 15 Left 1070351696 10:75598926-75598948 CCAGGCTTTAATCAGTTGTATGA 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1070351699 10:75598964-75598986 TGCATTCCTTGTCCATCAGGTGG No data
1070351696_1070351701 23 Left 1070351696 10:75598926-75598948 CCAGGCTTTAATCAGTTGTATGA 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1070351701 10:75598972-75598994 TTGTCCATCAGGTGGCAAAGAGG No data
1070351696_1070351698 12 Left 1070351696 10:75598926-75598948 CCAGGCTTTAATCAGTTGTATGA 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1070351698 10:75598961-75598983 TTGTGCATTCCTTGTCCATCAGG No data
1070351696_1070351703 28 Left 1070351696 10:75598926-75598948 CCAGGCTTTAATCAGTTGTATGA 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1070351703 10:75598977-75598999 CATCAGGTGGCAAAGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070351696 Original CRISPR TCATACAACTGATTAAAGCC TGG (reversed) Intronic
902162583 1:14543286-14543308 TCATGCAACTTATTAATGCAAGG - Intergenic
904101498 1:28032911-28032933 TCATACAATTAGTAAAAGCCTGG - Intronic
904802073 1:33100017-33100039 TCATACAACTTTTTATACCCAGG - Intronic
908437100 1:64117897-64117919 TCATACAAATAATTAAAACAGGG + Intronic
917073708 1:171181159-171181181 TCATACAATTTTTTAAAGACTGG - Intergenic
922746913 1:228049330-228049352 TCATACAACTGAACGAAGGCAGG - Intronic
924019012 1:239760806-239760828 TCATGAAACTGCTTAAAGCCAGG - Intronic
1064703192 10:18043720-18043742 TAAGAAAACTGACTAAAGCCAGG - Intergenic
1070351696 10:75598926-75598948 TCATACAACTGATTAAAGCCTGG - Intronic
1071747865 10:88442368-88442390 TCATTCAGCTGATTAAAACTTGG + Intronic
1072641576 10:97215038-97215060 TCAAAGTACTTATTAAAGCCTGG + Intronic
1073720115 10:106158906-106158928 TCATACAAATGATTACACTCTGG + Intergenic
1074701028 10:116092710-116092732 CCATACAGCTGAGTAAAGCCTGG - Intronic
1074979661 10:118609296-118609318 TCATGCAACTGACTACAGGCTGG + Intergenic
1075511489 10:123075985-123076007 TCATACTGATGATAAAAGCCAGG - Intergenic
1075970782 10:126650374-126650396 TCATAGGCCTGATTTAAGCCTGG + Intronic
1077661495 11:4072479-4072501 TCACACAACTGCTTAGAGCCAGG + Intronic
1078104252 11:8348651-8348673 TTACACAACTGAGTCAAGCCTGG - Intergenic
1078795668 11:14590068-14590090 TCATACAAATGAAATAAGCCAGG + Intronic
1080819273 11:35789711-35789733 TCTTAGAACTGAGTAAGGCCCGG - Intronic
1082844106 11:57713250-57713272 TCATACAACTAATGAGTGCCTGG + Intronic
1084676266 11:70637351-70637373 GCACACAACTGATTAGACCCAGG + Intronic
1087182568 11:95154351-95154373 TCACTCAACTGATTAAATACTGG + Intergenic
1087900022 11:103629888-103629910 TCATACAACTGATGAGAGTTAGG - Intergenic
1090729839 11:129560907-129560929 TCATACAAATGACCAAAGCTTGG + Intergenic
1093658269 12:21722845-21722867 TCATAAAACTAATTAAATCAAGG - Intronic
1093895703 12:24572186-24572208 TCATACTACTGCTTAAAGTTTGG + Intergenic
1099717417 12:86313573-86313595 TCCTACAAGTGAGAAAAGCCAGG + Intronic
1100605301 12:96147534-96147556 TCATACACTTGAGTAATGCCTGG + Intergenic
1100777081 12:97986933-97986955 TTGTACAACTGATTAAAGAAAGG - Intergenic
1102637477 12:114336726-114336748 TCAGACACCTGACTAAAGTCTGG - Intergenic
1110442014 13:75536902-75536924 TCATATAACTAAGCAAAGCCAGG + Intronic
1112437113 13:99398482-99398504 TCATACAACTGGTAAGAGGCTGG - Intergenic
1112711430 13:102133754-102133776 TCATACAACAGAGTTAAGCATGG + Intronic
1113294459 13:108942975-108942997 TCATAGACCTGAATAAAGCAAGG - Intronic
1122585130 14:102800738-102800760 TCACACCACTGATTCTAGCCTGG - Intronic
1127976786 15:64003510-64003532 TCACTCAGCTGATTAAACCCAGG - Intronic
1130739276 15:86581130-86581152 TTATTCAACAAATTAAAGCCTGG + Intronic
1136643957 16:31592503-31592525 ACATGCAACTGATAAAACCCAGG - Intergenic
1140143005 16:72277309-72277331 TCATTCAAATGTTAAAAGCCAGG - Intergenic
1142609010 17:1097710-1097732 TCATTCACCTGCTGAAAGCCTGG + Intronic
1144129265 17:12230005-12230027 TCATACAACTCATTAGTGGCTGG + Intergenic
1144846137 17:18220527-18220549 TAAAACAACAGATTAAAGCCGGG - Intergenic
1152716826 17:81904243-81904265 TGGTACAACCGAATAAAGCCTGG - Intronic
1155777343 18:29781389-29781411 TCATACAAATTTTTAAAGCAGGG - Intergenic
1156312980 18:35941827-35941849 TCATACAACAGATTTTAGACAGG - Intergenic
1163076959 19:14902139-14902161 TAATACAACTCATTAAAGGGTGG - Intergenic
1166057792 19:40303476-40303498 TCATACCACTGACTCCAGCCTGG + Intergenic
927379462 2:22461977-22461999 TCATCCTAATGAGTAAAGCCTGG + Intergenic
927749019 2:25649841-25649863 TGATACAACTGAATAATGGCTGG + Intronic
928698787 2:33877842-33877864 TCATGCAACTGATTCAAACTTGG - Intergenic
928806655 2:35165259-35165281 ACATAAAACTGATTATAGACTGG - Intergenic
934160097 2:89241390-89241412 ACATACTACTAAATAAAGCCTGG + Intergenic
935826569 2:106957216-106957238 TCATAGAACTGAATAAACCCAGG + Intergenic
937359900 2:121221847-121221869 TCATATACCTGATAAAAGACTGG + Exonic
939903555 2:147881166-147881188 TCATTCAACTGAATAACACCTGG - Intronic
940020208 2:149148325-149148347 TCATAAAAGTGATTAAGGGCTGG + Intronic
943996118 2:194767748-194767770 TCCTACATCTGATTAATGTCTGG + Intergenic
949058311 2:241941927-241941949 TCAAACAACAGATGACAGCCTGG - Intergenic
1168985836 20:2048224-2048246 TCATGTAATTGATAAAAGCCTGG - Intergenic
1174236959 20:49102013-49102035 TCACACAGCTGGATAAAGCCGGG + Intergenic
1176037303 20:63045888-63045910 TCATAAAACCAATTCAAGCCTGG + Intergenic
1178581522 21:33842335-33842357 TCATACAACTTAAAAATGCCTGG - Intronic
1179600657 21:42475584-42475606 TCATGCAACAGAAGAAAGCCAGG + Intronic
1181970358 22:26685164-26685186 TCATGCCACTGATTCCAGCCTGG + Intergenic
1182154564 22:28057526-28057548 TCATATATCTGATAAAAGACTGG - Intronic
950231898 3:11283460-11283482 TCTTACACCTGAGTAAATCCAGG + Intronic
950660338 3:14463289-14463311 TCAGACAACTGAGAAGAGCCAGG - Intronic
950779950 3:15382770-15382792 CCATACAACTGATTAAATTTGGG + Exonic
953550648 3:43899770-43899792 TCAACCACCTTATTAAAGCCAGG - Intergenic
955516224 3:59729020-59729042 TGATACCAATGATTAAGGCCCGG - Intergenic
956351289 3:68339774-68339796 GCATACCACTGATTAGAGGCTGG - Intronic
956899566 3:73701119-73701141 TGAGACAACTGATTACAGTCTGG - Intergenic
958121192 3:89290997-89291019 TCATCCAAGTGATTTGAGCCTGG - Intronic
958558647 3:95712827-95712849 TGATATAAATGATTCAAGCCAGG - Intergenic
963443320 3:145369024-145369046 TCATACATGTGAATAAACCCTGG - Intergenic
965761930 3:172087553-172087575 TCACACCACTGATTAATGGCAGG - Intronic
968065836 3:195758865-195758887 ACATAGAACTGATTCAAGGCTGG - Intronic
968138829 3:196239272-196239294 TCATACCACAGATAAAAGCTGGG + Intronic
982382017 4:154759271-154759293 TTATACAAGTTATTAGAGCCTGG - Intergenic
982982746 4:162161983-162162005 TCATACAAATTTTGAAAGCCTGG - Intronic
983047806 4:163007550-163007572 AGATACACCTGAATAAAGCCAGG + Intergenic
983286082 4:165741145-165741167 TGACACAAATGATTAAGGCCAGG + Intergenic
986890405 5:12297622-12297644 TCTCAAAAATGATTAAAGCCAGG + Intergenic
987742636 5:21929559-21929581 TCATACCACTGATTCCAACCAGG - Intronic
987915715 5:24210890-24210912 TCATAAAACTGATAAAATCCTGG - Intergenic
996558500 5:124803175-124803197 TCATGAAACTGTTTAGAGCCTGG - Intergenic
997939674 5:138145862-138145884 TCATAGGACTGATCTAAGCCAGG - Exonic
999618223 5:153448017-153448039 TCAAACAACTGATGAAATCAAGG + Intergenic
1007002118 6:38323729-38323751 TCACACAACTGGTGAAGGCCTGG + Intronic
1010345040 6:74800939-74800961 TCATACCACTTATTCCAGCCTGG + Intergenic
1011523653 6:88239131-88239153 TCATAAAGCTGAAAAAAGCCAGG - Intergenic
1014780322 6:125557809-125557831 TCATACAACTCAGTCTAGCCTGG + Intergenic
1018136752 6:160786121-160786143 TTATTAAATTGATTAAAGCCTGG - Intergenic
1021608404 7:22432529-22432551 TCATACCACTGACTCCAGCCTGG + Intronic
1024390529 7:48806731-48806753 CCATGCAAGTCATTAAAGCCAGG + Intergenic
1028048390 7:86152321-86152343 CCATACAACTGATGAAATCTAGG - Intergenic
1028675812 7:93459330-93459352 TCATATAACTGATTGGAGCGGGG - Intronic
1030319878 7:108154662-108154684 TCACACCACTTATTAAAGACTGG - Intronic
1031409535 7:121424673-121424695 TCATGCAACAGATTAAAGGAAGG + Intergenic
1033592446 7:142821912-142821934 TCTAACAAATGATTAAAGCCAGG + Intergenic
1034032584 7:147784740-147784762 TGTTAGAACTGATAAAAGCCAGG + Intronic
1042376021 8:68053886-68053908 TCACACAAGTGAATACAGCCAGG - Intronic
1042761166 8:72272844-72272866 TCATACAAATGATATGAGCCTGG - Intergenic
1045480940 8:102591622-102591644 TTTTAAAACTGATTACAGCCAGG + Intergenic
1046471364 8:114679307-114679329 TCATTCAGCTGTTTATAGCCAGG + Intergenic
1047746377 8:127848254-127848276 TAATACACCTGACCAAAGCCAGG + Intergenic
1048402550 8:134085432-134085454 TGATACAAGTGATTGAAACCAGG - Intergenic
1050465227 9:5915288-5915310 TCATTCACCTGACTAAAGACAGG - Intronic
1050944765 9:11502235-11502257 TCATACAAGAGAATAATGCCTGG + Intergenic
1051420474 9:16884126-16884148 TCATGCAACTGACTCCAGCCTGG + Intergenic
1051759514 9:20445967-20445989 TAAGACAAATGGTTAAAGCCAGG + Intronic
1052950375 9:34204850-34204872 TCTTGCAACTGAATAAAGACTGG - Intronic
1058656351 9:107225072-107225094 TCATAAAACTGCTTCAAGGCCGG + Intergenic
1059567030 9:115393015-115393037 TCATACAGCTAATAAAGGCCAGG - Intronic
1186193423 X:7088052-7088074 TCAAACCACTGATCAATGCCTGG + Intronic
1189718409 X:43888608-43888630 TCATACATCTGATAAAAAGCTGG - Intergenic
1193234994 X:79095875-79095897 TCTTAAAACTGATTCATGCCAGG - Intergenic
1195679478 X:107533399-107533421 CCATATACCTGAATAAAGCCAGG + Intronic
1196180194 X:112681063-112681085 TCATATCACTGATAAAAGGCAGG - Intergenic
1198392011 X:136185631-136185653 TCACATAACTAATTGAAGCCAGG - Intronic
1199070562 X:143470308-143470330 TCATATCACAGATTAAACCCTGG + Intergenic
1199289908 X:146093824-146093846 TCATACAGCTGCTGAAATCCAGG + Intergenic