ID: 1070351699

View in Genome Browser
Species Human (GRCh38)
Location 10:75598964-75598986
Sequence TGCATTCCTTGTCCATCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070351696_1070351699 15 Left 1070351696 10:75598926-75598948 CCAGGCTTTAATCAGTTGTATGA 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1070351699 10:75598964-75598986 TGCATTCCTTGTCCATCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070351699 Original CRISPR TGCATTCCTTGTCCATCAGG TGG Intronic
No off target data available for this crispr