ID: 1070355977

View in Genome Browser
Species Human (GRCh38)
Location 10:75640661-75640683
Sequence TTCCCATAGCGGTCAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070355969_1070355977 1 Left 1070355969 10:75640637-75640659 CCTCTCCCATCTGCAGCCTCTGC 0: 1
1: 1
2: 5
3: 108
4: 798
Right 1070355977 10:75640661-75640683 TTCCCATAGCGGTCAGGCTGGGG No data
1070355968_1070355977 2 Left 1070355968 10:75640636-75640658 CCCTCTCCCATCTGCAGCCTCTG 0: 1
1: 2
2: 10
3: 94
4: 735
Right 1070355977 10:75640661-75640683 TTCCCATAGCGGTCAGGCTGGGG No data
1070355970_1070355977 -4 Left 1070355970 10:75640642-75640664 CCCATCTGCAGCCTCTGCATTCC 0: 1
1: 0
2: 3
3: 46
4: 477
Right 1070355977 10:75640661-75640683 TTCCCATAGCGGTCAGGCTGGGG No data
1070355971_1070355977 -5 Left 1070355971 10:75640643-75640665 CCATCTGCAGCCTCTGCATTCCC 0: 1
1: 0
2: 3
3: 77
4: 743
Right 1070355977 10:75640661-75640683 TTCCCATAGCGGTCAGGCTGGGG No data
1070355967_1070355977 3 Left 1070355967 10:75640635-75640657 CCCCTCTCCCATCTGCAGCCTCT 0: 1
1: 0
2: 5
3: 84
4: 738
Right 1070355977 10:75640661-75640683 TTCCCATAGCGGTCAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070355977 Original CRISPR TTCCCATAGCGGTCAGGCTG GGG Intronic
No off target data available for this crispr