ID: 1070357478

View in Genome Browser
Species Human (GRCh38)
Location 10:75654560-75654582
Sequence TAGAATAAAGAGAAGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1475
Summary {0: 1, 1: 0, 2: 6, 3: 137, 4: 1331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070357478_1070357485 23 Left 1070357478 10:75654560-75654582 CCCCTCTCCTTCTCTTTATTCTA 0: 1
1: 0
2: 6
3: 137
4: 1331
Right 1070357485 10:75654606-75654628 TTGCCAGTTTGTTTGTCTTAGGG No data
1070357478_1070357482 -9 Left 1070357478 10:75654560-75654582 CCCCTCTCCTTCTCTTTATTCTA 0: 1
1: 0
2: 6
3: 137
4: 1331
Right 1070357482 10:75654574-75654596 TTTATTCTAGAAATATTTCCTGG No data
1070357478_1070357484 22 Left 1070357478 10:75654560-75654582 CCCCTCTCCTTCTCTTTATTCTA 0: 1
1: 0
2: 6
3: 137
4: 1331
Right 1070357484 10:75654605-75654627 TTTGCCAGTTTGTTTGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070357478 Original CRISPR TAGAATAAAGAGAAGGAGAG GGG (reversed) Intronic
901206073 1:7496658-7496680 TAAAATAAAGGCAGGGAGAGAGG + Intronic
901222913 1:7594042-7594064 AACAAAAAAGAGAAAGAGAGAGG + Intronic
901744217 1:11361918-11361940 GGGAAGAAAGGGAAGGAGAGAGG + Intergenic
901860868 1:12073500-12073522 AAGAAAGAAGAGAAGGAGGGAGG - Intronic
903299712 1:22370134-22370156 AAGAAGGAAGGGAAGGAGAGAGG - Intergenic
903357131 1:22755025-22755047 TGCAACAAAGAGCAGGAGAGGGG - Intronic
903791780 1:25898148-25898170 TAGAATAAAAAAATGGGGAGGGG + Intronic
904542338 1:31241404-31241426 GAGAAAAGAGAGAATGAGAGGGG + Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905471945 1:38199131-38199153 TAGAAAAAAGAGGTGGAGAGTGG + Intergenic
905524492 1:38625892-38625914 TGGAAAAAAGAGAAAGAGGGAGG + Intergenic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
906031100 1:42720722-42720744 AAAAATAAAAAGAAGGTGAGAGG + Intergenic
906558936 1:46739638-46739660 GAGACTAGAGAGAAGAAGAGAGG - Intergenic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907300562 1:53484090-53484112 AAGAATAAAGAGCATGAAAGGGG + Intergenic
907311305 1:53540598-53540620 AAGAAGAAATAGCAGGAGAGGGG + Intronic
907443643 1:54493534-54493556 TGGAGTAAAGGGAATGAGAGGGG - Intergenic
907621300 1:55983482-55983504 GGGAAGAAAGAGGAGGAGAGGGG + Intergenic
907902603 1:58754800-58754822 TAAAAGAAAGAAAAGGAGAGAGG - Intergenic
907954667 1:59216750-59216772 AGAAAGAAAGAGAAGGAGAGAGG + Intergenic
908030125 1:59990219-59990241 TAGAATAATGACCAGGAGAAGGG + Intronic
908220636 1:62002407-62002429 TAAAAGAAAGAAAAAGAGAGCGG + Intronic
908462944 1:64363844-64363866 TAGAATGAAAAAAGGGAGAGGGG - Intergenic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908603777 1:65770960-65770982 TTGAAGAAAGAGAAAGAAAGTGG - Intergenic
908614637 1:65905629-65905651 GAGAATAGAGAGAGGGGGAGTGG + Intronic
909080125 1:71100547-71100569 TAGCATCAAGTGAAGGAGACTGG + Intergenic
909202191 1:72704748-72704770 TAGAAGAAAGAGATAGAGATAGG + Intergenic
909502807 1:76354100-76354122 TACTAGAAAGAGAAGGAGAGTGG - Intronic
909684483 1:78331857-78331879 AAGAAGAAAGAGAAGGAGAGAGG - Intronic
909785999 1:79614424-79614446 TGGAACAAAGAGAAAGACAGAGG + Intergenic
909932102 1:81507984-81508006 TAAAGTCAAGAGAAGGAGATTGG - Intronic
910229078 1:84967867-84967889 AAGAAGGGAGAGAAGGAGAGAGG + Intronic
910668994 1:89754132-89754154 TAGAGGACAGAGAAGGAGAATGG - Intronic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
910977245 1:92919722-92919744 AAGAATAAAGAAATGGAGGGAGG + Intronic
911068491 1:93813086-93813108 TGAAATACAGAGAAGGAGAAAGG - Intronic
911139927 1:94488898-94488920 TGGAAAAAAGAGAAAGAAAGGGG - Intronic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911509237 1:98791149-98791171 CAGCAGAAAGAGGAGGAGAGGGG + Intergenic
911550949 1:99280046-99280068 AAGAATTAAGAGAAACAGAGTGG + Intronic
911854244 1:102856602-102856624 GAAAATAAAGAAAAGGAGGGGGG - Intergenic
912075181 1:105865403-105865425 GAGAATAGAATGAAGGAGAGAGG + Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912547904 1:110464617-110464639 TAGAAAAAGCATAAGGAGAGTGG + Intergenic
912923897 1:113896113-113896135 GAGAAAAAAATGAAGGAGAGAGG + Intronic
913100458 1:115559348-115559370 GAGAAGAAAGAGATGGAGATTGG - Intergenic
913283838 1:117209921-117209943 AAGAAGAGAGGGAAGGAGAGAGG - Intronic
913338416 1:117732741-117732763 AAGAACAAAGAGAAGGTTAGAGG - Intergenic
913349441 1:117841939-117841961 TAAAATAAAGGAAAGTAGAGGGG + Intergenic
913672129 1:121106970-121106992 TAGAATAATGAGCAGGAGAAAGG - Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914023893 1:143894327-143894349 TAGAATAATGAGCAGGAGAAAGG - Intergenic
914392658 1:147236298-147236320 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
914412967 1:147449329-147449351 TAAAATAAAGAGAGAGAGAAAGG - Intergenic
914450849 1:147790154-147790176 TAAAATGAAGAAAAGCAGAGAGG + Intergenic
914460972 1:147884888-147884910 TAGAACAAAAAGCAGGAGAAAGG + Intergenic
914662383 1:149802366-149802388 TAGAATAATGAGCAGGAGAAAGG - Intronic
914730695 1:150367504-150367526 AAGAAAAAAGAGAAGCAAAGTGG - Intronic
914945800 1:152064860-152064882 TAGAATGAAAACCAGGAGAGTGG - Intergenic
915264549 1:154707516-154707538 TAGACAAAAGGAAAGGAGAGAGG + Exonic
915369646 1:155337785-155337807 TGGAATAAGGAGTAGGAGATTGG - Intronic
915504277 1:156343312-156343334 CAGAATAATGGGAAGAAGAGCGG + Intronic
915609225 1:156977809-156977831 TGGAATAAAGTCAAGGAGTGGGG - Intronic
915716556 1:157950121-157950143 AAAAAGAAAGAGAAGGGGAGGGG + Intergenic
916149333 1:161771129-161771151 AAGAGAAGAGAGAAGGAGAGAGG - Intronic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916452100 1:164930539-164930561 GGGAAGAAAGAGAAGGAGGGAGG - Intergenic
916649631 1:166822685-166822707 AAGTTTAAGGAGAAGGAGAGAGG + Intergenic
916976564 1:170086680-170086702 AATAAAAAAGGGAAGGAGAGAGG - Intergenic
917305118 1:173616873-173616895 AAGAATGAAGAAAAGTAGAGTGG + Intronic
917439015 1:175049867-175049889 TAGGAGAAGGAGAAGGTGAGGGG + Intergenic
917439195 1:175051788-175051810 AAAAAAAAAGAAAAGGAGAGTGG + Intergenic
917520941 1:175748059-175748081 TGGAAAAAAGAGATGGAGAGAGG + Intergenic
917813969 1:178688751-178688773 TGGAATTAAGAGAAAGGGAGTGG + Intergenic
917930499 1:179819283-179819305 GAGAAAACTGAGAAGGAGAGAGG - Intergenic
918014587 1:180620882-180620904 TAGTTAAAAGAGAAGGAGAATGG + Intergenic
918096664 1:181341692-181341714 AAGAATAAAGGAAAGAAGAGAGG - Intergenic
918469983 1:184861800-184861822 AAGAAGAGAGAGAAGGAGGGAGG + Intronic
918993221 1:191725600-191725622 GAGAAAAAAGAGAAAGAGAGAGG + Intergenic
919069571 1:192736685-192736707 TTGAAGAAAGTGATGGAGAGAGG - Intergenic
919253458 1:195091119-195091141 TAGAAGTAAGAGCAGAAGAGTGG - Intergenic
919357335 1:196540730-196540752 TGAAATAATGAGAAAGAGAGGGG - Intronic
919368137 1:196691832-196691854 TAGAATAAAGAATAGTATAGTGG - Intronic
919392962 1:197010533-197010555 AAGAAGAAAAAGAAAGAGAGAGG + Intergenic
919431737 1:197502537-197502559 TACAATTAAGAGAAAGAGAGAGG + Intergenic
919529204 1:198694795-198694817 TAAAAGAAAGGGAGGGAGAGAGG - Intronic
919780870 1:201220150-201220172 TAGAAAGAAGAGAGGGAGGGAGG - Intronic
920425113 1:205868867-205868889 TAGAATTAAGAGAAGGAAAAGGG - Intergenic
920988640 1:210914695-210914717 CAGAAGAACTAGAAGGAGAGAGG + Intronic
921080520 1:211735518-211735540 CAGAACAAAGAAAAGGGGAGGGG - Intergenic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921309087 1:213825020-213825042 GAGAAGAAAGAGTGGGAGAGAGG + Intergenic
921538127 1:216377927-216377949 AAAAAGAAAGAGAAGGAGAGAGG + Intronic
921640296 1:217544994-217545016 GAGAAAAACAAGAAGGAGAGGGG - Intronic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
922037979 1:221868056-221868078 TAGAATAAAGAAGACTAGAGAGG + Intergenic
922108905 1:222538607-222538629 TAAAATAAAAAGAGGGAGAAGGG + Intronic
922438490 1:225629770-225629792 TAGAATAAAGAGCAATAGGGAGG - Intronic
922642895 1:227253174-227253196 TGGAAAAAAGAGAGAGAGAGAGG + Intronic
922651943 1:227348229-227348251 TAGAAGAAAGAGAAGAGGAGAGG - Intergenic
922781693 1:228257447-228257469 TAAAATAAAAAAAAGGAAAGAGG - Intronic
922936293 1:229425710-229425732 GAGAAGAAAGAGGAGGAGGGGGG + Intergenic
923405625 1:233656243-233656265 AAGAACAAAGAGAAGGTTAGAGG + Intronic
923569086 1:235098472-235098494 AAGGAAAAAGAGAGGGAGAGGGG + Intergenic
923597578 1:235372622-235372644 TAGAAAAGAGAGAGAGAGAGAGG + Intronic
923645659 1:235818165-235818187 TAAAAAAGAAAGAAGGAGAGTGG + Intronic
923879457 1:238087448-238087470 AAGAACAAAGAGAAGGTTAGAGG + Intergenic
924062075 1:240185201-240185223 TAAAAGAAAGAGAAGGAAAAAGG - Intronic
924089913 1:240491712-240491734 TAAAAGAAAGAGAAAAAGAGAGG - Exonic
924147151 1:241088233-241088255 TAGAATCAAGAGAGTGAGAGAGG + Intronic
924147273 1:241089234-241089256 TAGAATCAAGAGAGCAAGAGAGG + Intronic
924315520 1:242791446-242791468 TAGACTGAAGAGAAAGAGATGGG + Intergenic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924494697 1:244575738-244575760 TAGGGGAAAGGGAAGGAGAGGGG - Intronic
924595077 1:245437992-245438014 TAGAAAAAATAAAACGAGAGAGG - Intronic
924793660 1:247276369-247276391 TAGAATAGAGAGGAGTAGAATGG + Intergenic
1062880177 10:972014-972036 AAAAATAAAGAGAGAGAGAGAGG - Intergenic
1063010299 10:2015168-2015190 AAGAAGAATGAGAAAGAGAGAGG - Intergenic
1063105375 10:2987511-2987533 GAGAAAAAAGAGGAAGAGAGAGG - Intergenic
1063159486 10:3408875-3408897 AGGAAGAAAGAGGAGGAGAGAGG + Intergenic
1063164813 10:3451676-3451698 TAGAGGAAAGAGGAGGAGGGAGG - Intergenic
1063714399 10:8513428-8513450 AAGAAGAAAGAGAGAGAGAGAGG - Intergenic
1063724770 10:8624684-8624706 TAAAATAAAGAGAAGGCCAATGG + Intergenic
1064199971 10:13275995-13276017 TAGAAAAAAGAGTGGGGGAGGGG + Intergenic
1064340919 10:14484606-14484628 AAGAACAAAGAGAAGGTTAGAGG - Intergenic
1064454068 10:15470382-15470404 TAGACAAGAGAGAAGGGGAGGGG - Intergenic
1065052260 10:21807140-21807162 AAGAATAAAGAAAAAGAAAGAGG + Intronic
1065101087 10:22334340-22334362 GAAAATAAGGAAAAGGAGAGAGG - Intergenic
1065199184 10:23297454-23297476 TAGAATTAAGAGAAGGAAAAAGG - Intronic
1065798122 10:29325743-29325765 TTGAATAAAGAAAAGGAAAGAGG + Intergenic
1066028585 10:31392686-31392708 TAGAATAAAAAGAAATATAGAGG + Intronic
1066057163 10:31692681-31692703 TAGAAGAAAGAGAGGGATGGGGG + Intergenic
1066129221 10:32374439-32374461 TAGAGAAAAGAGATGAAGAGAGG - Intronic
1066238267 10:33507957-33507979 TAAAAGACAGAGAAGGAGGGAGG - Intergenic
1066395990 10:35022208-35022230 AACAATAAAGAGAAGGAAACAGG + Intronic
1066499462 10:35975869-35975891 TAGAAGAAAGAGAAGCATAAGGG - Intergenic
1066627310 10:37419897-37419919 TAGAAGAAAGAGAAGCATAAGGG - Intergenic
1067150213 10:43726257-43726279 TTTTATAAAGAGGAGGAGAGGGG - Intergenic
1067200722 10:44169571-44169593 CAGGATACAGAGAACGAGAGAGG - Intergenic
1067736245 10:48853263-48853285 TAGAAGAAAGCTCAGGAGAGGGG - Intronic
1067797256 10:49329576-49329598 AGGAAGAGAGAGAAGGAGAGAGG - Intergenic
1068202629 10:53802313-53802335 GAGAAAAAAGAGACAGAGAGAGG + Intergenic
1068236690 10:54244167-54244189 TAGAATAAAGAGTATGATATTGG - Intronic
1068621619 10:59189810-59189832 CAGAAGAAAAAGTAGGAGAGGGG + Intronic
1068877275 10:62010169-62010191 TATGAGAAAGAAAAGGAGAGAGG + Intronic
1069135144 10:64754535-64754557 TAGAATAAAGTAATGGATAGAGG + Intergenic
1069841963 10:71345601-71345623 TGGAAGAATGAGAAGGAGAGGGG + Intronic
1069971406 10:72173254-72173276 AAGAATAAAGAGAAAGAAAAAGG - Intronic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070403761 10:76076392-76076414 AAGAAGAAAGAGAAAGAGAGAGG - Intronic
1070500406 10:77067237-77067259 TAGAATAAAAAGGAGGAGTAAGG + Intronic
1070605768 10:77897669-77897691 AAAGAGAAAGAGAAGGAGAGGGG + Intronic
1070737196 10:78871322-78871344 TAGAATGAAGAGAATGAGCAGGG - Intergenic
1070830910 10:79417641-79417663 ATGAAGAAAGAGAAGAAGAGTGG + Intronic
1070852753 10:79581121-79581143 AAGAAGAAAGAGAAAAAGAGAGG + Intergenic
1070990980 10:80731989-80732011 AAGAAAAAAGAGAAAAAGAGAGG - Intergenic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1071709294 10:88033743-88033765 TATAATGAAGAGATGGAGCGTGG - Intergenic
1071792747 10:88973147-88973169 CAGAAGAAAGGGAAGGTGAGAGG - Intronic
1072800033 10:98386280-98386302 TAGAAGGAAGAGAGGGAGGGAGG + Intronic
1073178345 10:101569841-101569863 GAGAAGAAAGAGATGGGGAGAGG - Intergenic
1073324245 10:102633408-102633430 TAGATTACAGAGAGGAAGAGGGG - Exonic
1073448985 10:103598330-103598352 GAGAATAGTGAGGAGGAGAGGGG + Exonic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073586466 10:104715278-104715300 TAGAACAAAAAGGAGGAGAAAGG + Intronic
1073728341 10:106260939-106260961 TAAAATAAAGAGATGGATAAAGG + Intergenic
1073740982 10:106406572-106406594 TAAAAGAAAGAGAAGGATGGAGG + Intergenic
1073778880 10:106815297-106815319 AGGAATAAAGGGAGGGAGAGAGG + Intronic
1073805482 10:107093336-107093358 GAGAATAGAGTGAAGGGGAGAGG - Intronic
1073862318 10:107761181-107761203 TAAGATAGAAAGAAGGAGAGAGG + Intergenic
1073975038 10:109090865-109090887 TAGAATAAAATGCAGGAGAAAGG - Intergenic
1074165089 10:110868009-110868031 TAGATGACAGAAAAGGAGAGAGG - Intergenic
1074293921 10:112165047-112165069 AAAAATAAAGAGAAAGAAAGTGG + Intronic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1075207397 10:120458738-120458760 TAGAAAATAGAGTAGGAGAAGGG - Intronic
1076489709 10:130850072-130850094 AAGATGAAGGAGAAGGAGAGGGG - Intergenic
1077762551 11:5118984-5119006 GAGAAGAGAGAGGAGGAGAGGGG + Intergenic
1077857420 11:6142672-6142694 AAGAATAGAGGCAAGGAGAGAGG + Intergenic
1078000695 11:7492736-7492758 AAGAAGAGAGGGAAGGAGAGTGG - Intronic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078808782 11:14736691-14736713 GACACTATAGAGAAGGAGAGAGG + Intronic
1078841500 11:15079786-15079808 GGGAATAAAGAGAAGAAGGGAGG + Intronic
1078885250 11:15493543-15493565 GAGAATATAGAGGAGGGGAGAGG - Intergenic
1078899915 11:15632266-15632288 TAGAAGAAAGAAAAGAAGACTGG - Intergenic
1078914296 11:15763806-15763828 AAGAAGAGAGAGAAGGAGGGAGG + Intergenic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079148882 11:17879891-17879913 GAGAATTAAGAGAATCAGAGTGG - Intronic
1079301203 11:19280497-19280519 AAGAAGAAAGAGAAGAAGAAAGG - Intergenic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079501507 11:21105881-21105903 AAGAATAAAGAGGAGAGGAGAGG - Intronic
1079530932 11:21452113-21452135 AAAAGAAAAGAGAAGGAGAGAGG + Intronic
1079834148 11:25310350-25310372 AAGAAAAAAGAGAAAGAAAGAGG + Intergenic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1080825205 11:35842538-35842560 GAGATAAATGAGAAGGAGAGAGG + Intergenic
1081117306 11:39219413-39219435 AAGAAAAAAGAAAAAGAGAGAGG + Intergenic
1081153351 11:39659369-39659391 TAGAATAGAGATATGGAGGGTGG + Intergenic
1081235398 11:40641401-40641423 TAAAATAAATAGAAAGAGTGGGG - Intronic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081374074 11:42338821-42338843 AAGAAAGAAAAGAAGGAGAGGGG - Intergenic
1081842512 11:46213297-46213319 TAAAAAAAGGAGAAGGACAGAGG - Intergenic
1082714782 11:56598931-56598953 TAGAATAAAGTGAAGAAAATGGG - Intergenic
1082735474 11:56850957-56850979 TATAAGAAAGAGATGGAGTGGGG + Intergenic
1082950231 11:58806984-58807006 GAGTATTAAGACAAGGAGAGAGG + Intergenic
1082960407 11:58914016-58914038 TAGCATAAAGAGAGAGAAAGTGG - Intronic
1084100524 11:66945157-66945179 TCAAATAAAGAGAAAGAGGGTGG - Intronic
1084158953 11:67334189-67334211 TCAAAAAAAGAGAAGGGGAGGGG - Intronic
1084757534 11:71249272-71249294 TGGAAGAAAGGGAAGGAGAGGGG - Intronic
1085174190 11:74472381-74472403 TGGAAGAGAGAGAAGAAGAGGGG - Intergenic
1085447818 11:76612683-76612705 AAAAATAAAGAAAAGGAAAGAGG - Intergenic
1085488665 11:76892325-76892347 AAAAATAAAGAGAATGAAAGTGG - Intronic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1085879753 11:80452441-80452463 TAGAAAGAAGAGAGAGAGAGAGG + Intergenic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086165425 11:83772435-83772457 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1086186682 11:84025906-84025928 AAGAAAAAAGAGAAGAGGAGAGG + Intronic
1086219009 11:84419113-84419135 TACAGAAAAGAGAAGGCGAGAGG + Intronic
1086318955 11:85624861-85624883 AAGAAGAAAGGGAAGGAGGGAGG + Intronic
1086367320 11:86120730-86120752 TAGAAGAAAGGAAAAGAGAGAGG - Intergenic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086475962 11:87174566-87174588 TAGCATCTAGAGAAGAAGAGAGG + Intronic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086527281 11:87742549-87742571 GAGAATAAAGTGAAAGTGAGGGG + Intergenic
1086564340 11:88208402-88208424 TAGAGTAAAGAGTAGAATAGTGG - Intergenic
1086571058 11:88285130-88285152 TAGAATAAATAAAAGAAGGGTGG - Intergenic
1086580025 11:88388696-88388718 AAGTATAAAGATAAAGAGAGAGG - Intergenic
1087344265 11:96950763-96950785 TGGAATATAGAGAAGAACAGAGG - Intergenic
1087429808 11:98038608-98038630 TAGAATGAAAGGAAGGAGAAAGG - Intergenic
1088823654 11:113476036-113476058 GAAAAGAAAGAAAAGGAGAGAGG - Intergenic
1088824654 11:113483565-113483587 AAGAAAGAAGAAAAGGAGAGAGG + Intergenic
1089028601 11:115298364-115298386 TAGAATGAGGAGAAGAAGAAAGG + Intronic
1089196300 11:116695798-116695820 TAGAAGGGAAAGAAGGAGAGAGG - Intergenic
1089355960 11:117854053-117854075 AGAAAGAAAGAGAAGGAGAGAGG - Intronic
1089484834 11:118837222-118837244 AAGAATAAGAAGAATGAGAGAGG + Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1090603432 11:128396095-128396117 TAGAACAAAGAGACAGAGGGAGG + Intergenic
1090776983 11:129974486-129974508 CAGAATAAGTAGAAGGTGAGGGG + Intronic
1091478476 12:801089-801111 AACAATAAAGAGGATGAGAGAGG - Intronic
1092069583 12:5621822-5621844 AAGAAGAAAGAGAAGGGAAGGGG + Intronic
1092288187 12:7142091-7142113 AAGAACAAAGAGAAGGAAAAGGG + Exonic
1092355320 12:7789806-7789828 GGGAAAAGAGAGAAGGAGAGAGG + Intronic
1092367972 12:7892769-7892791 AAGAGAAAAGGGAAGGAGAGAGG + Intergenic
1092724146 12:11468541-11468563 AAGAAAAAAGAGAATGAAAGGGG - Intronic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093102650 12:15046421-15046443 TAGAATAAAGAAAGGAAGAAGGG - Intergenic
1093204661 12:16232971-16232993 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1093550845 12:20408978-20409000 CAGAAGAAAGGGAGGGAGAGAGG - Intronic
1093739872 12:22672681-22672703 CAAACTAAAGAGAAGGAAAGGGG + Intronic
1093808298 12:23463536-23463558 AAGATTCAGGAGAAGGAGAGTGG - Intergenic
1093855339 12:24094954-24094976 TTGGATAAACAAAAGGAGAGAGG - Intergenic
1094023654 12:25940648-25940670 TGTAAGAAAGAGAGGGAGAGGGG - Intergenic
1094035719 12:26068357-26068379 TAGAAGAAAAAGAAGGAAAAGGG - Intronic
1094050027 12:26209005-26209027 AAGAATAAAATGAAGGAGGGTGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094492953 12:30972656-30972678 TTGAATAAAGTGAAGGGCAGAGG + Intronic
1094551623 12:31457257-31457279 TAGGATAGAGAGAATGAGAGTGG - Intronic
1094695091 12:32809861-32809883 GAGAATAAAGAAAAGCAGAGTGG - Intronic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1095120505 12:38412284-38412306 TAAAATAAAGAGGAGAATAGAGG - Intergenic
1095232519 12:39757868-39757890 TACAATAAAGAGAAGGATTGAGG + Exonic
1095266682 12:40167775-40167797 AAGAATTAACAGAAAGAGAGAGG + Intergenic
1095328901 12:40932991-40933013 TTGAAAAGAGAGAAGGAGAGAGG - Intronic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095762679 12:45857756-45857778 TAAAAAAAAGAGAGAGAGAGAGG - Intronic
1095783190 12:46083440-46083462 TAGATTAAAGAGGAGAAAAGAGG + Intergenic
1096089930 12:48892290-48892312 AAGGAGAAAGAGAAAGAGAGAGG - Intergenic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1096755304 12:53794368-53794390 TAGAATAAAGGGACAGAGAAAGG + Intergenic
1096859009 12:54509645-54509667 TAGAAGAAAGCAGAGGAGAGGGG - Intronic
1096983540 12:55742817-55742839 TAGGAAAAGGAGGAGGAGAGAGG - Intergenic
1097021908 12:56026738-56026760 TAGAATAGAGAGAGGCAAAGGGG - Intronic
1097176757 12:57147727-57147749 TAGAATAGAAAGAAGGAAGGAGG + Intronic
1097309978 12:58108548-58108570 TGGAGTCAAGAGAAGGAGAAAGG - Intergenic
1097462622 12:59881088-59881110 TAGGATGAAGAGATGGTGAGTGG - Intergenic
1097514897 12:60593094-60593116 AAGAATAAAGTGAGGAAGAGAGG + Intergenic
1097539334 12:60917867-60917889 AAGAATAAAGAGCAAGAAAGTGG - Intergenic
1098085766 12:66841246-66841268 AAGAAAAGAGAGAAGGAGAAAGG - Intergenic
1098394107 12:70000272-70000294 AAGCATCCAGAGAAGGAGAGAGG - Intergenic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098745453 12:74232130-74232152 TAGAAGAAAGAGGAGGAAAGTGG - Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099603740 12:84775125-84775147 AAGAATATGGAGAAAGAGAGGGG - Intergenic
1099746783 12:86714734-86714756 AATAATACAGAGAAGGAGTGAGG + Intronic
1099785099 12:87252269-87252291 TAAAACAAAGAGGAGGAGAAAGG - Intergenic
1099989237 12:89707063-89707085 GAGGATAAAGAAAAAGAGAGGGG + Intronic
1100153427 12:91769459-91769481 GAGAACAAAGAAAAGAAGAGAGG + Intergenic
1100260279 12:92926872-92926894 TAGAATAATGAAGAGGACAGAGG - Intronic
1100273601 12:93049547-93049569 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1100343525 12:93704481-93704503 TGGAATATACAGAAGGAAAGAGG - Intronic
1100416631 12:94384732-94384754 GAGAATAAAGAGAAGAAAATTGG - Intronic
1100580778 12:95938431-95938453 AAGGATAAAGGGAATGAGAGTGG - Intronic
1100615290 12:96226795-96226817 TAAAAAGAAAAGAAGGAGAGGGG + Intronic
1100668284 12:96779828-96779850 TAGAAAAAAGAAAGGAAGAGAGG + Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100787003 12:98089324-98089346 TAGAATAAAGTGAATGAGGCAGG - Intergenic
1101008889 12:100429936-100429958 CAGAAGAAAGAGAAGGGAAGAGG - Intergenic
1101021987 12:100562367-100562389 GAGAATATAAAGAAAGAGAGTGG + Intronic
1101063916 12:100999684-100999706 AAGAAAAGAGAGAGGGAGAGAGG + Intronic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101255624 12:102973968-102973990 TGGAAGGAAGTGAAGGAGAGAGG - Intergenic
1101261731 12:103039144-103039166 CAGAATAAACACAAGGAAAGAGG - Intergenic
1101348167 12:103905283-103905305 GAGAAGGAAGGGAAGGAGAGAGG + Intergenic
1101388883 12:104282112-104282134 AAGAACAAAGAGAAGGTTAGAGG + Intronic
1101580504 12:106037764-106037786 GAGAAGGAAGAGAAGGAGAGGGG - Intergenic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101802012 12:108030693-108030715 TAGAAGCAAGAGATGGAGATGGG + Intergenic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102382249 12:112477022-112477044 AAGAAAAAAGAAAAGGGGAGGGG - Intronic
1102798375 12:115709533-115709555 GAGATTAAAGAGAGTGAGAGAGG + Intergenic
1102817023 12:115874746-115874768 CAAAAGAGAGAGAAGGAGAGAGG + Intergenic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1103295620 12:119884059-119884081 AGGAAAAGAGAGAAGGAGAGAGG + Intergenic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103540345 12:121661874-121661896 AGAAAGAAAGAGAAGGAGAGAGG + Intronic
1103593984 12:122011977-122011999 TCAAAGAAGGAGAAGGAGAGAGG + Intergenic
1103671906 12:122624119-122624141 AAGAACAAAGAGAAGGTTAGAGG - Intronic
1104091474 12:125521320-125521342 TGGAATAAGGAAAAGGAGAAGGG - Intronic
1104111457 12:125708922-125708944 TGGACTAAAGACAAGGAGTGAGG - Intergenic
1104150650 12:126079214-126079236 TGGAACCAAGAGAAGGAAAGAGG + Intergenic
1104253278 12:127116982-127117004 TATAATCAAAAGAAGGAGACGGG - Intergenic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1105515954 13:21090912-21090934 TGTAATAAAAGGAAGGAGAGGGG - Intergenic
1105532614 13:21233309-21233331 TAGGACTAAGAGAATGAGAGGGG - Intergenic
1105752971 13:23438851-23438873 TAGATGAAAGAGTAGGGGAGGGG + Intergenic
1105839932 13:24245405-24245427 AAGTACAAAGAGAAGGATAGAGG - Intronic
1106105470 13:26729140-26729162 TAGAATAAAGAAGAGGAAATGGG + Intergenic
1106142694 13:27024704-27024726 GAGAATAAACACAAGGCGAGGGG - Intergenic
1106374242 13:29169291-29169313 TAGAATAAAAAGAAGCACATTGG + Intronic
1106449517 13:29867369-29867391 AGGATTAAAGAGAAGGGGAGGGG + Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106999514 13:35527025-35527047 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
1107328641 13:39272899-39272921 GAAAAGAAAGAGAAGAAGAGAGG + Intergenic
1107375710 13:39801989-39802011 GAGAAGAAAGAGAGGGAAAGGGG + Intergenic
1107650727 13:42542063-42542085 GAAGATAAAGAGAAGGAGAGAGG - Intergenic
1107711754 13:43157451-43157473 TAGAATAATGAGGTTGAGAGAGG + Intergenic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1108243468 13:48491785-48491807 TAGAATAAAGTAAAGGAGCATGG - Intronic
1108555416 13:51586362-51586384 TGGAATCAAGAAAAGGAGAAGGG + Intronic
1108851128 13:54730671-54730693 TAGAATAAAAAGACAGAGGGAGG - Intergenic
1108896574 13:55335637-55335659 CAGAAGCAAGAGAAAGAGAGTGG - Intergenic
1108907133 13:55490541-55490563 AGGAAGGAAGAGAAGGAGAGAGG + Intergenic
1108974211 13:56417570-56417592 TAAAATAAAGACAAAGACAGTGG + Intergenic
1109110407 13:58311410-58311432 TATAGTCAAGAGAAAGAGAGAGG + Intergenic
1109162944 13:58999000-58999022 AGGAAAAGAGAGAAGGAGAGAGG + Intergenic
1109215160 13:59581266-59581288 TAGAAGAAAAAGAAGAAAAGAGG - Intergenic
1109273874 13:60283103-60283125 TAGGCTAGAGAGATGGAGAGAGG - Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109550297 13:63887777-63887799 TAGCATAAAGCCTAGGAGAGGGG + Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1109863518 13:68231324-68231346 TGGCAGGAAGAGAAGGAGAGAGG - Intergenic
1109912765 13:68937460-68937482 TAGAATAAAGAATAGTGGAGAGG - Intergenic
1109922169 13:69079257-69079279 GAGGAGAAAGAGTAGGAGAGAGG - Intergenic
1110046287 13:70836260-70836282 AAGAAAAAAGAGATGGAGAGAGG - Intergenic
1110335306 13:74323295-74323317 AACACTAAAAAGAAGGAGAGAGG - Intergenic
1111368306 13:87280476-87280498 TAGGACAAAGAGAGAGAGAGAGG + Intergenic
1111423582 13:88050620-88050642 TACAATAAACAGTAGGATAGAGG + Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112154683 13:96804338-96804360 TGGTATAAAGAGGAGGAGGGAGG + Intronic
1112177089 13:97036554-97036576 AAGAAAAAAGAAAAGGGGAGGGG + Intergenic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1112584509 13:100706305-100706327 AAGAAGAAAGAGAAGGGGAGAGG - Intergenic
1112743591 13:102502776-102502798 TAGAAAAAAGATAATGGGAGTGG + Intergenic
1112917856 13:104573125-104573147 TAAAGGAAAGAGAAAGAGAGAGG + Intergenic
1113174080 13:107541473-107541495 AAAGAGAAAGAGAAGGAGAGAGG + Intronic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114261493 14:21039938-21039960 TAGGATAATGAGAAGTAGAAAGG + Intronic
1114348953 14:21828820-21828842 TATAATCAACAGAAGAAGAGTGG - Intergenic
1114358976 14:21949153-21949175 TATAATCAATAGCAGGAGAGTGG - Intergenic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1115097239 14:29651609-29651631 AATAATAATGAGAAGGAGAGAGG - Intronic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115590668 14:34861672-34861694 TAAATTAAAGAGAAGGAAGGTGG + Intronic
1115913562 14:38283791-38283813 TAGAATAAAGACAAGGTCATAGG + Intergenic
1116050198 14:39793384-39793406 TAGAATAATCAGGAGGAGAACGG - Intergenic
1116070670 14:40040905-40040927 TAGAAGAAAGAAAAGAAGGGAGG - Intergenic
1116206442 14:41873379-41873401 CAGAAGAGAGAGAAAGAGAGAGG + Intronic
1116237675 14:42300185-42300207 TAGAGAATAAAGAAGGAGAGAGG + Intergenic
1116312048 14:43340200-43340222 TAGGAGAAAGAGAAGAAGAAAGG + Intergenic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1116665140 14:47764926-47764948 TAGAAGGAGAAGAAGGAGAGAGG + Intergenic
1116699721 14:48224572-48224594 AGGAAGAAAGAAAAGGAGAGAGG + Intergenic
1116790225 14:49332034-49332056 TAGAATGAAGGGAGGGAGAAAGG - Intergenic
1116808802 14:49519852-49519874 AAGAAGGAAGAAAAGGAGAGAGG + Intergenic
1116862710 14:50007421-50007443 TACAGTAAAGACAAGGAGAATGG + Exonic
1117159521 14:52974933-52974955 AAAAAACAAGAGAAGGAGAGTGG - Intergenic
1117274714 14:54181187-54181209 TACAATCAAGGAAAGGAGAGAGG - Intergenic
1117389245 14:55247442-55247464 GAGATTAAAGAGAGAGAGAGAGG + Intergenic
1118136087 14:63029655-63029677 GAGAAAAATGAGAAGAAGAGAGG + Intronic
1118145327 14:63128516-63128538 TAGGATCAAGAGAAAGAGAGAGG - Intergenic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118411123 14:65479541-65479563 AAGAAGAAAGGGAAGGAGGGAGG - Intronic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118604069 14:67490312-67490334 GAGAATGAAGAGAGGCAGAGTGG + Intronic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119123018 14:72097567-72097589 AAGAATGAAGAGGAGGAGAAGGG + Intronic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119683351 14:76609811-76609833 TATAAAAAAGAGAGTGAGAGAGG + Intergenic
1119724742 14:76915083-76915105 GAAAATCAAAAGAAGGAGAGAGG + Intergenic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1120230117 14:81832907-81832929 GAGAAGGAGGAGAAGGAGAGTGG - Intergenic
1120260370 14:82176940-82176962 TTGTACAAAGAGAAGGAGATTGG - Intergenic
1120266778 14:82260809-82260831 AAAAATAATGAGAAGGAAAGAGG + Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120311983 14:82840526-82840548 TCTAATAAAGAGAAGAAGAATGG - Intergenic
1120623787 14:86799064-86799086 TAAACTAAAGAGACAGAGAGAGG + Intergenic
1121184689 14:91956392-91956414 AAGAATAAAAAAAGGGAGAGAGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121833655 14:97073096-97073118 AAGAAGAAAGGGAGGGAGAGAGG - Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122357624 14:101132921-101132943 TAGATCAAACAGAAGGAAAGGGG + Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122623044 14:103070603-103070625 CAGAACAAAGAGGAGGAGAGAGG - Intergenic
1122962798 14:105105218-105105240 TACAAAAAAGAAAAGGAGAAAGG + Intergenic
1124352419 15:28967417-28967439 AAAAATAAAGGGATGGAGAGAGG - Intronic
1124406985 15:29401985-29402007 TAGATTAAGGAGGAGGCGAGGGG + Intronic
1124470371 15:29978930-29978952 GAGAAGAAAGAGAGAGAGAGAGG + Intergenic
1125283256 15:38066092-38066114 GAGAAAAAGGGGAAGGAGAGAGG + Intergenic
1125333564 15:38605511-38605533 TAGAAAACAGAGGAGGAGAAAGG - Intergenic
1125626341 15:41112425-41112447 TAGCATATAGAGAATGAGAAGGG - Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126242829 15:46465422-46465444 TGAAATACAGAGAAGGAAAGAGG - Intergenic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127646280 15:60962574-60962596 TAGGGTAAAGTGGAGGAGAGCGG - Intronic
1128253286 15:66178779-66178801 CAAAAGAGAGAGAAGGAGAGTGG + Intronic
1128440302 15:67701129-67701151 TAGAATGAAGAAATGGAGAGAGG + Intronic
1128602262 15:69006591-69006613 TGAAAAAAAGAGAGGGAGAGTGG - Intronic
1128650419 15:69408248-69408270 TAGCATGAAGAGAATGAGCGTGG - Intergenic
1128916690 15:71569311-71569333 AAGAAGAAAGAGAGAGAGAGAGG + Intronic
1129743317 15:78000837-78000859 TAGATTGAAGAGAGGGAGGGAGG - Intronic
1130127427 15:81105409-81105431 AAGAAAGAAGAGAAGGAGTGAGG - Intronic
1130347165 15:83058323-83058345 TACAATGAAGAGAAAAAGAGAGG - Intronic
1130387382 15:83423568-83423590 GAGCAGAAAGAGAGGGAGAGAGG + Intergenic
1130398246 15:83523740-83523762 AAGAAGAGAGAGAAGGAGGGAGG - Intronic
1130750044 15:86701862-86701884 AAGAAAAAAGAGAAGGGAAGGGG - Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130759250 15:86800815-86800837 GAGAATAAAGAAATGGAGACTGG + Intronic
1131297096 15:91158723-91158745 GAGAAAAAAGAGGAGAAGAGAGG - Intronic
1131651807 15:94408289-94408311 TACAATAACCAGAAGAAGAGGGG + Intronic
1131653507 15:94428979-94429001 TAGAAGAGTGAAAAGGAGAGTGG - Intronic
1131989184 15:98076932-98076954 AAAGAAAAAGAGAAGGAGAGAGG + Intergenic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1133009266 16:2901337-2901359 AAAAATAAAGAACAGGAGAGGGG - Intergenic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133526141 16:6607602-6607624 AAGAAGAGAGAGAAAGAGAGAGG - Intronic
1134030406 16:10987912-10987934 TTGAAGAGAGAGAAGCAGAGGGG + Intronic
1134103010 16:11465749-11465771 TAAAAGAAAGAGAAGGCGGGGGG + Intronic
1134105872 16:11485707-11485729 AAGAATAGATAGAAGGAGAGGGG - Intronic
1134306594 16:13038450-13038472 TGGAATAGAGCAAAGGAGAGTGG - Intronic
1134357465 16:13497383-13497405 ATCAATAAAGAAAAGGAGAGGGG + Intergenic
1134453642 16:14378720-14378742 TGGAAGAAAGAGATGGGGAGGGG + Intergenic
1134691795 16:16195682-16195704 AGGAAGAAAGAGAGGGAGAGAGG - Intronic
1134752053 16:16633044-16633066 TAGAATAGGGAGATGGGGAGAGG - Intergenic
1134866337 16:17610695-17610717 AAGAAGAAAGGGAAGGAGGGAGG - Intergenic
1134880987 16:17745401-17745423 GAGCAAACAGAGAAGGAGAGAGG - Intergenic
1135149064 16:19989503-19989525 GAGAAAGAAAAGAAGGAGAGAGG - Intergenic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1136006593 16:27334578-27334600 ATGAATAAAGAGAAACAGAGAGG - Intronic
1136404582 16:30036762-30036784 TCAAAGAAAGAAAAGGAGAGGGG + Intronic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137229346 16:46548819-46548841 TGGAATAAACAGAAGGCCAGTGG - Intergenic
1137383894 16:48023790-48023812 TGAAAGAAAGAGAATGAGAGAGG + Intergenic
1137552265 16:49445712-49445734 TAGAAAGCAGAGAGGGAGAGAGG - Intergenic
1137578550 16:49620111-49620133 TAGAAGAGAGAGAGGGAAAGAGG - Intronic
1137800999 16:51262087-51262109 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1138003006 16:53301747-53301769 AAGAAAAAAAAGAAAGAGAGAGG - Intronic
1138248952 16:55487862-55487884 AAGAATGAAGAGGAGGAGGGAGG - Intronic
1138757484 16:59505967-59505989 GAGAGTAGAGAGAAGTAGAGGGG + Intergenic
1138846421 16:60572801-60572823 TAAAAAAAAGAGAGAGAGAGAGG - Intergenic
1139056066 16:63185888-63185910 TACAAAAAAGAGAAAGAGAAAGG + Intergenic
1139072893 16:63404371-63404393 TAGAATAAAGACTAGGAGGAGGG - Intergenic
1139097784 16:63726795-63726817 AAGAAAAAAGAGAAAGAGAAAGG - Intergenic
1139253559 16:65519705-65519727 CATTATAAAGAGAAGGGGAGAGG - Intergenic
1139868124 16:70080067-70080089 GAGAAGAAAGAGAAGGGAAGTGG - Intergenic
1140139548 16:72242391-72242413 TAGAATAAAGAGAACTAAGGAGG - Intergenic
1140140033 16:72246842-72246864 AGGAAGAAAGAGAGGGAGAGAGG + Intergenic
1140260523 16:73374419-73374441 AATAATAAAGTGAAGGAGAGTGG - Intergenic
1140318724 16:73926924-73926946 TAGCAGAACGAGGAGGAGAGAGG - Intergenic
1140387211 16:74551786-74551808 GAGAAGAAAGAGAAGGGAAGTGG + Intronic
1140903571 16:79392109-79392131 GAGAGGAAAGAGAAGAAGAGAGG + Intergenic
1140957466 16:79878575-79878597 TTGTAAAAAGAGAGGGAGAGGGG - Intergenic
1141089443 16:81120181-81120203 TACAACAAAGGGATGGAGAGTGG + Intergenic
1141696961 16:85624727-85624749 TGGAATAAACAGGTGGAGAGAGG + Intronic
1141877222 16:86834224-86834246 TAAAAAAAAGAGAGAGAGAGAGG + Intergenic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142928323 17:3260302-3260324 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
1143143328 17:4755713-4755735 TGAAAGAAAGAAAAGGAGAGAGG + Intergenic
1143198061 17:5091763-5091785 GAGAATAATGAGAGTGAGAGAGG + Exonic
1143228913 17:5334228-5334250 CAAAAAAAAGAGAAGGAAAGGGG - Intronic
1143602990 17:7961322-7961344 AAAAAAAAAGAGAAAGAGAGAGG + Intergenic
1143698453 17:8638635-8638657 TAGAACAAAGAGAAGAAGCACGG + Intergenic
1143711492 17:8739104-8739126 AAGAAAAAAGAGAAAGAGAGGGG + Intronic
1143849566 17:9800187-9800209 AAAAAAAAAGAGAGGGAGAGAGG - Intronic
1144237185 17:13272894-13272916 TAGAAGGAAGGGAAGGAGGGAGG + Intergenic
1144284036 17:13755477-13755499 AGAAAGAAAGAGAAGGAGAGAGG - Intergenic
1146528032 17:33583657-33583679 TAGAAACTATAGAAGGAGAGGGG + Intronic
1146672979 17:34754667-34754689 TAGAAGAGAGAGACGGGGAGGGG + Intergenic
1147251969 17:39158094-39158116 TCGAAGAAAGGGAAGGAGGGAGG + Intronic
1147308428 17:39579259-39579281 TGGGAAAAACAGAAGGAGAGAGG + Intergenic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148955115 17:51347308-51347330 AAAAATGATGAGAAGGAGAGAGG - Intergenic
1149080674 17:52653065-52653087 AAGAAAAGAGAGAAAGAGAGAGG + Intergenic
1149219072 17:54393906-54393928 TAGTTTAAAGATAAGGAAAGAGG - Intergenic
1149262322 17:54893444-54893466 TAGAATCAGGAGAAGCACAGGGG + Intergenic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1150011066 17:61504312-61504334 TGGAATGAAGAGAGGAAGAGAGG - Intergenic
1150196653 17:63305790-63305812 TGGTATGAAGAGAAGAAGAGGGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150813018 17:68371326-68371348 AAAAAAAAAAAGAAGGAGAGAGG + Intronic
1151188030 17:72378393-72378415 TTGAAAAGAGAGAAAGAGAGAGG + Intergenic
1151474150 17:74336050-74336072 AAGCATAAAGCCAAGGAGAGAGG - Intronic
1151522977 17:74643921-74643943 TAGAAGAGAGAGAAGGAAGGTGG + Intergenic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1152006590 17:77686008-77686030 AGGAATAGAGAGATGGAGAGTGG - Intergenic
1153506488 18:5804394-5804416 CAGGAGAAAGAGAGGGAGAGAGG - Intergenic
1153518775 18:5932096-5932118 TAAAATATAGAGAAAGGGAGTGG + Intergenic
1153752664 18:8249203-8249225 TAGAGAAAAGAGAAGCAGAGGGG - Intronic
1153757806 18:8301544-8301566 TTGAATAAAGATCAGAAGAGAGG - Intronic
1153794771 18:8611471-8611493 TAGAATGCAGAAGAGGAGAGAGG + Intronic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1153826630 18:8881445-8881467 TAGGGGAAAGGGAAGGAGAGAGG - Intergenic
1153890140 18:9506035-9506057 AAGAACAAAGAGAAGGTTAGGGG + Intronic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155180540 18:23341729-23341751 TAGGAAAAAGAGAGAGAGAGGGG + Intronic
1155317308 18:24584887-24584909 TAAAAAACAGAGAAGGAGATGGG + Intergenic
1155780402 18:29825510-29825532 TAGGGTAAAGAGTAGGACAGTGG - Intergenic
1155837277 18:30601797-30601819 AAGAAAAAAGGGAAGGGGAGGGG - Intergenic
1156036770 18:32772872-32772894 GAGAAAAGAGAGAAAGAGAGAGG + Exonic
1156099017 18:33571484-33571506 TAGAATAAAAGAAAGGAGAATGG + Intergenic
1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG + Intronic
1156234905 18:35193180-35193202 TTGAATAAAGAGAAGTTGATGGG - Intergenic
1156463801 18:37336221-37336243 CAGGATAGAGAAAAGGAGAGAGG - Intronic
1156592321 18:38504994-38505016 AAGAAGAAACAAAAGGAGAGGGG - Intergenic
1156666317 18:39412188-39412210 AAGAAGGAAGTGAAGGAGAGAGG - Intergenic
1156669312 18:39448476-39448498 GAAAAGAAAGAGAAAGAGAGAGG + Intergenic
1156671142 18:39471179-39471201 TAGAAAAAAGCAAGGGAGAGAGG + Intergenic
1156690168 18:39697799-39697821 TAGAACCAAGAGAAGGAGAAGGG - Intergenic
1156723816 18:40103313-40103335 AAGAAAGAAGAAAAGGAGAGAGG - Intergenic
1156930886 18:42641875-42641897 TAGATAAAAGAGAAGGACAGGGG + Intergenic
1157211292 18:45744752-45744774 TAGAAATCACAGAAGGAGAGGGG - Intronic
1157331495 18:46707367-46707389 GAGAAAAAAGAGATGCAGAGAGG - Intronic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157442525 18:47721686-47721708 CAGAATAAAAGGAAGGAAAGAGG + Intergenic
1158109820 18:53928776-53928798 AAAAAAAAAGAAAAGGAGAGGGG + Intergenic
1158178287 18:54682668-54682690 TAATATATGGAGAAGGAGAGGGG - Intergenic
1158547388 18:58407811-58407833 TAGAATGCAGAGAAGGCAAGAGG - Intergenic
1158710517 18:59833345-59833367 TAGAATTAAGAAAAAGAGAAAGG - Intergenic
1158734257 18:60061936-60061958 TAGAATATAGAGAAGGATCCTGG + Intergenic
1158841583 18:61393965-61393987 AAAATTAATGAGAAGGAGAGTGG - Intronic
1158855719 18:61541921-61541943 GAGAACAGAGAGCAGGAGAGCGG + Intronic
1159381299 18:67663301-67663323 TAAAAGAAAGGGAAAGAGAGGGG - Intergenic
1159736874 18:72111012-72111034 TAGAAGAAAGTGAAGGAGGGAGG + Intergenic
1159823731 18:73178732-73178754 GAGAATCAAGAGATGGAGAGGGG + Intronic
1160039190 18:75330238-75330260 AGGAATGATGAGAAGGAGAGAGG + Intergenic
1160041259 18:75347746-75347768 AAGAATGAAGAGAGGGAGGGAGG + Intergenic
1160045795 18:75386219-75386241 TAGAAAGAGGAGCAGGAGAGAGG - Intergenic
1160132092 18:76234548-76234570 GAGAATAAAGAAAGGAAGAGAGG - Intergenic
1160705048 19:525767-525789 GAGAAGGAAGAGAAGGAGAGAGG + Intergenic
1161267394 19:3370621-3370643 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
1161277606 19:3427447-3427469 TAGAAAGAAAAGAAGGAGAGAGG + Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1162585031 19:11553235-11553257 TAGAAGGTGGAGAAGGAGAGCGG + Exonic
1162984109 19:14258338-14258360 AAGAACAAAGGGAAGGGGAGGGG - Intergenic
1163091147 19:15021279-15021301 GAGAATAGAGAGAGGGACAGGGG + Intronic
1163276084 19:16285191-16285213 AAGAAGAAAGAGAAGGGGAAGGG + Intergenic
1163276093 19:16285236-16285258 AAGAAGAAAGAGAAGGGGAAGGG + Intergenic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1163976623 19:20858847-20858869 TAGGGGAAAGGGAAGGAGAGGGG + Intronic
1164173877 19:22750830-22750852 TAGAATTAAGAAAAGGAAAAAGG + Intergenic
1164249795 19:23466689-23466711 AAGGAGAAAGAGGAGGAGAGGGG - Intergenic
1164249916 19:23467465-23467487 GAGAAGAGAGAGAAGAAGAGAGG - Intergenic
1164426294 19:28144946-28144968 AAGAAGAAAGAGGATGAGAGAGG - Intergenic
1164581675 19:29438852-29438874 AAGAAAAGAGGGAAGGAGAGAGG + Intergenic
1164629114 19:29749751-29749773 AAGAATAAAGGGAAGAAGAAAGG - Intergenic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1165925262 19:39322083-39322105 TCTCAGAAAGAGAAGGAGAGTGG - Intergenic
1166618018 19:44268765-44268787 GAGAAAGAATAGAAGGAGAGGGG - Intronic
1166662570 19:44656991-44657013 TAAATTAAAGAGAAGGGGATGGG + Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166986844 19:46665632-46665654 AAAAAAAAAGACAAGGAGAGAGG - Intergenic
1167112159 19:47468864-47468886 TATCAAAAAGAGAAGGAGAGAGG + Intronic
1167251820 19:48402896-48402918 TTGAATAAAAAGGAGGATAGGGG + Intronic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168236416 19:55066419-55066441 GAGAAGACAGAGAGGGAGAGAGG - Intronic
1168357245 19:55709122-55709144 AAGAATAAAGAGGAGAGGAGAGG - Intronic
925549491 2:5055886-5055908 AATAATAAAGCGAAAGAGAGTGG - Intergenic
925554883 2:5120308-5120330 TATAATCAAGACAAGAAGAGAGG + Intergenic
926189232 2:10715394-10715416 GAGAAAGAAGAGAAGGAGTGTGG - Intergenic
926376683 2:12236151-12236173 GAGAATAAGGAGAGAGAGAGAGG - Intergenic
926433894 2:12818428-12818450 AGGAAGAAAGGGAAGGAGAGAGG - Intergenic
927338208 2:21950039-21950061 GAAAAGAAAGAGAAGGAGACAGG - Intergenic
927995018 2:27478777-27478799 TATAATAAATGGAAGGACAGAGG + Intronic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928559184 2:32461186-32461208 TAGAAAAAAGGGAAGGGGAGGGG - Intronic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
929172799 2:38948533-38948555 AGGAAGAAAGGGAAGGAGAGAGG + Intronic
929244311 2:39685464-39685486 TAGAGTCTAGAGAAGGACAGGGG - Intronic
929336659 2:40756386-40756408 AAGAAAAAAGAGACAGAGAGAGG - Intergenic
929518677 2:42627527-42627549 CATAATAAAGAGAATGTGAGGGG - Intronic
929545131 2:42850730-42850752 TAGAAGCCTGAGAAGGAGAGAGG + Intergenic
929589546 2:43136046-43136068 TGGGAGGAAGAGAAGGAGAGGGG + Intergenic
929829844 2:45338195-45338217 TAGAAAAAAGAAAGGAAGAGAGG - Intergenic
929931150 2:46256507-46256529 TAGAACACAGTGAAGGGGAGAGG - Intergenic
929937589 2:46305210-46305232 AAGCATAAAGTGAAGAAGAGTGG + Intronic
929998330 2:46843746-46843768 AAGAATAAAGAAAAAGATAGTGG - Intronic
930230515 2:48839639-48839661 GAGAAAATAGAGAAAGAGAGAGG - Intergenic
930309256 2:49716892-49716914 GAGAATAAAGAGAAAGTTAGAGG - Intergenic
930348955 2:50224666-50224688 AAGATTAAAGAGAGAGAGAGAGG + Intronic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
931508493 2:62960268-62960290 TAGAATGAAAAAAATGAGAGAGG - Intronic
931667921 2:64623515-64623537 TGGAACAAAGAGTAGGGGAGAGG + Intergenic
931676154 2:64698241-64698263 TAGAAGGATTAGAAGGAGAGGGG + Intronic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
931908439 2:66868512-66868534 GAGAGAAAAGAGATGGAGAGTGG + Intergenic
931975188 2:67636413-67636435 AAGAATGAAGAGAAGTAAAGAGG - Intergenic
932027609 2:68151365-68151387 CTGAATGAAGAGAAGGATAGAGG - Intronic
932469570 2:71945070-71945092 TGGAAGAAAGAGAAGAAAAGGGG + Intergenic
932516206 2:72352533-72352555 TAGATTAAAGAGAAAGAAAGAGG + Intronic
932729891 2:74212148-74212170 AAGAAGGAAGGGAAGGAGAGAGG - Intronic
932888347 2:75568185-75568207 AAGATTAAAGAGAAGGAAAGAGG - Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933110042 2:78386448-78386470 TATAATAAAGAAAAGGTGAAGGG + Intergenic
933168377 2:79098441-79098463 TAGAATGAGGAAAAAGAGAGAGG + Intergenic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
933227897 2:79772130-79772152 AGGAAGAAAGGGAAGGAGAGAGG - Intronic
933392182 2:81685208-81685230 AGGAATAAAGAGATGGAAAGGGG + Intergenic
933478348 2:82820807-82820829 AAGAAGAAAGAGAGAGAGAGAGG - Intergenic
933505350 2:83170328-83170350 TAGGAAAAAAAGAAGGAGAAGGG - Intergenic
934652343 2:96099808-96099830 CAGAAGGAAGAGAAGGGGAGGGG + Intergenic
935093541 2:99920649-99920671 TTGAATAAAGATAGTGAGAGTGG - Intronic
935111678 2:100099799-100099821 AAGAAAAAAGAGAAAGAAAGAGG + Intronic
936080664 2:109430454-109430476 AGGAAGAAAGAGAAGGGGAGAGG - Intronic
936112136 2:109673736-109673758 TGGAAGAAGGAGAAAGAGAGAGG + Intergenic
936221396 2:110606096-110606118 AAGAAAAAAGAGAAAGAAAGAGG + Intergenic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
936527998 2:113255185-113255207 AGGAATAGAGGGAAGGAGAGAGG + Intronic
936639733 2:114298534-114298556 AAGGAGGAAGAGAAGGAGAGTGG + Intergenic
936640777 2:114310669-114310691 AAGAATATAGAGAAAGAGATAGG - Intergenic
936709373 2:115114196-115114218 AAGAACAAAGAGAAGGCTAGAGG - Intronic
936932205 2:117801662-117801684 TAGATTAATGAGAAGGGAAGTGG - Intergenic
937162526 2:119778230-119778252 TAGAAAATGGAGAGGGAGAGAGG + Intronic
937193158 2:120124019-120124041 AAGAATAAAGAAGAGGAAAGGGG + Intronic
937259472 2:120576392-120576414 AAGAAGAAACAGAAGCAGAGCGG + Intergenic
937547374 2:123039068-123039090 AAGGAAAAAGAGAAGAAGAGAGG + Intergenic
937553773 2:123129184-123129206 TCCCATAAAGAGGAGGAGAGGGG + Intergenic
937595502 2:123666967-123666989 TTGAAGACAGTGAAGGAGAGAGG + Intergenic
937611717 2:123869570-123869592 TTGAATTAAGAAAATGAGAGTGG - Intergenic
937628478 2:124070364-124070386 TCCAATAAAGAGAAACAGAGTGG + Intronic
937648401 2:124292601-124292623 TAGATTGAAGAGAAGCATAGAGG + Intronic
937933524 2:127223720-127223742 AAGAATACAGAGAAAGACAGGGG + Intergenic
937943741 2:127311878-127311900 AAGAAAAAAGAAAAGGAGATTGG - Intronic
938145587 2:128832499-128832521 AAGAAAAAAGAAAAGGAGGGAGG - Intergenic
938429926 2:131225023-131225045 AAGAGTAAGGAGTAGGAGAGAGG - Intronic
938999895 2:136722145-136722167 AGGAATAAAGGGAAGGAAAGAGG - Intergenic
939143499 2:138384199-138384221 TAGAATAAAGAGTAAAATAGTGG + Intergenic
939222369 2:139318929-139318951 TAGAATAAAGAGATGGGTGGGGG - Intergenic
939299738 2:140320073-140320095 TAGATTAAATGGAAGGAGGGAGG - Intronic
939413857 2:141866817-141866839 GAGAGAAAATAGAAGGAGAGAGG + Intronic
939443398 2:142277596-142277618 GAGAAGAAAGAGATGGAGATGGG - Intergenic
939669445 2:144992149-144992171 TAGAATTTAGAGAAGGACAACGG - Intergenic
939758558 2:146145071-146145093 TAGGAAAAAAAGAGGGAGAGGGG + Intergenic
939928608 2:148204041-148204063 AGGAAGAAAGAAAAGGAGAGAGG + Intronic
939931011 2:148232879-148232901 TTGAGAAAAGAGAAGGAGACTGG - Intronic
940016419 2:149110960-149110982 TAGAATAAAGTGAAGTAGTGTGG + Intronic
940520099 2:154734673-154734695 TGTAAGAAAGAGAAGGAAAGAGG + Intronic
940529651 2:154864923-154864945 TAGAATAAAGACAAAGAGGGAGG - Intergenic
940531420 2:154882615-154882637 GAGTATAAAGAGAAGGAAAGGGG - Intergenic
940818318 2:158321633-158321655 CAGAAGAAAGAGAGGGAAAGGGG - Intronic
941006211 2:160249751-160249773 TAAAAAAAAGAAAAGGAGAGGGG + Intronic
941044720 2:160661037-160661059 TAGAACAAAGACAAAGAAAGAGG + Intergenic
941190617 2:162377182-162377204 TAGAATAAAGTGGAGGTGAAAGG + Intronic
941265466 2:163356348-163356370 TATAATACAGGGAAGGAGAATGG + Intergenic
941281403 2:163556149-163556171 TATTGTAAAGAGAAAGAGAGAGG + Intergenic
941401041 2:165031491-165031513 AAGAAAAAAGAGAGAGAGAGAGG - Intergenic
941430320 2:165406788-165406810 TGGAAAAAGGAGAAAGAGAGAGG + Intergenic
942195315 2:173512296-173512318 AAGAACAAAGAGAAGGTTAGAGG - Intergenic
942303341 2:174583531-174583553 TAGAATATAGAGATGAAGAAAGG - Intronic
942398291 2:175575294-175575316 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
942430171 2:175902204-175902226 TAAAAGAAACAGAAAGAGAGAGG - Intergenic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942582194 2:177430642-177430664 GAGAACAAAGAAAAGGAGGGTGG - Intronic
942724364 2:178990559-178990581 AGGAAAAAAGAGAAGGGGAGGGG + Intronic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
942881138 2:180862191-180862213 TAGCATAATGAAAAGGAAAGAGG - Intergenic
943293892 2:186112716-186112738 TAGAATAAAAAGATATAGAGTGG - Intergenic
943366098 2:186968919-186968941 AAGAACAAAGAGAAGGTTAGAGG - Intergenic
943394397 2:187314726-187314748 TTGAAGAAAGAGAAAGAGAGAGG - Intergenic
943535266 2:189140671-189140693 TTTAATAAAAAGAAGGGGAGGGG - Intronic
943937870 2:193946841-193946863 TTGGATATAGAGAATGAGAGAGG - Intergenic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
944054848 2:195512983-195513005 AAGAAAATAGAGAAGGTGAGAGG + Intergenic
944085129 2:195836973-195836995 GAGAGAAAAGAGATGGAGAGAGG - Intronic
944141932 2:196466215-196466237 TTGAATAAAGAGTTGGAAAGTGG + Intronic
944204385 2:197142262-197142284 TAGAATAAAGAAAACGGAAGTGG + Intronic
944541608 2:200758786-200758808 TTGAATAAAGAGTGGGAGAATGG + Intergenic
944684347 2:202105109-202105131 AAAAATAAAGAAAAGGAAAGGGG + Intronic
944995431 2:205288441-205288463 TAAATTAAAGGGAAAGAGAGTGG - Intronic
945004639 2:205391220-205391242 TAGAGAAAAGGGAAGGAAAGAGG + Intronic
945223962 2:207512817-207512839 TGGAGCAAACAGAAGGAGAGTGG + Intergenic
945371863 2:209028667-209028689 AGGGAGAAAGAGAAGGAGAGAGG + Intergenic
945575073 2:211520504-211520526 AAGAAAGAAGAGAAGGGGAGAGG + Intronic
945608222 2:211963608-211963630 AAGAGGAAAGAGAGGGAGAGAGG - Intronic
945830471 2:214778279-214778301 TAAAATAAAGCTAAGGCGAGAGG + Intronic
945892820 2:215448415-215448437 AAGAATAAAGAGAATAAGAAAGG + Intergenic
945958712 2:216109755-216109777 TGGGATAAAGAGAGAGAGAGGGG - Intronic
946123482 2:217537866-217537888 TATAATAAAGAGACTGAGAAAGG + Intronic
946345827 2:219109650-219109672 GAGAATAAAGGAAAGGGGAGGGG + Intronic
946535175 2:220619962-220619984 GAGAAGCAAGAGAAAGAGAGAGG - Intergenic
946640164 2:221775370-221775392 GAGAATGCAGAGAGGGAGAGAGG - Intergenic
946882652 2:224191974-224191996 TAGTATAAAGACCAGGAGATTGG + Intergenic
946976398 2:225157123-225157145 TAGCACAAAAAGAAGGAGAAAGG + Intergenic
947011146 2:225568380-225568402 CAAAATAAATAAAAGGAGAGTGG - Intronic
947091052 2:226511891-226511913 AAGAATAGAGAAAAGGAGTGAGG - Intergenic
947130247 2:226915367-226915389 GAGAAGAAAGGGAAGAAGAGTGG + Intronic
947345840 2:229188358-229188380 GAGAAAAGAGAGAAGGAAAGGGG + Intronic
947707152 2:232285515-232285537 TAGAATCTAGAGAAGGGGAAAGG + Intronic
947977112 2:234376289-234376311 AAGAATAAAGGGAAGAAGGGAGG - Intergenic
948317347 2:237038502-237038524 TAGAAAAATGAGAAGGCAAGGGG + Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1168903946 20:1389442-1389464 TGGAATAAAGCAGAGGAGAGGGG + Intronic
1168964810 20:1892929-1892951 TTGAACTTAGAGAAGGAGAGGGG - Intergenic
1169009833 20:2241298-2241320 AAGAAAAAAGAGAAAGAAAGAGG - Intergenic
1169369400 20:5016983-5017005 AAAAAAAAAGAGAAGGAGACAGG - Intergenic
1169525987 20:6426253-6426275 AAGAAGAAAGAGAAGGGGAGAGG - Intergenic
1169541650 20:6606333-6606355 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1169541798 20:6607397-6607419 AAGAAGAGAGGGAAGGAGAGCGG + Intergenic
1169572552 20:6922433-6922455 TAGAATTGAGAGATGGTGAGGGG + Intergenic
1169770836 20:9198363-9198385 TAGAAGAAAGAGAAGAAGGTAGG + Intronic
1170336677 20:15277797-15277819 AAGAAGAAAGAAAGGGAGAGAGG + Intronic
1170339211 20:15304542-15304564 AAGAAGAAAGAGATGGGGAGGGG - Intronic
1170462785 20:16594012-16594034 AAGAAAAAAGAGAAGAGGAGAGG + Intergenic
1170463866 20:16605076-16605098 GAGAATAAAGAAGAGGAGAAGGG + Intergenic
1170465231 20:16616862-16616884 AAGGAAAAAGAGAAGGAAAGAGG + Intergenic
1171089604 20:22271498-22271520 CAGACTAAAGAGAGAGAGAGAGG + Intergenic
1171151935 20:22834986-22835008 AAGAATAGAGGGAGGGAGAGAGG - Intergenic
1172305254 20:33876073-33876095 AAGAAGGAAGAGAAGGAGAGGGG + Intergenic
1173500877 20:43552230-43552252 CAGAATAAAAAGAAAAAGAGAGG + Intronic
1173881516 20:46416543-46416565 TAGCATAAAGAGCATGACAGAGG - Intronic
1173928903 20:46801945-46801967 TTAAATAAAGAGAGAGAGAGAGG - Intergenic
1173955559 20:47029742-47029764 TAGAAAAAAGAAAAAGAGATGGG - Intronic
1174214671 20:48907154-48907176 AAAAAGAAAGAGAAAGAGAGAGG - Intergenic
1174394681 20:50239655-50239677 TAGAATGATGAGAAGGAGCTGGG + Intergenic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1174500187 20:50978636-50978658 AAGAAAAAAGAAAAAGAGAGGGG - Intergenic
1174666030 20:52258576-52258598 AGGAAGAAAGAGAATGAGAGGGG - Intergenic
1174672744 20:52323231-52323253 GTGAATAAAGAGAAGAAAAGAGG + Intergenic
1174723880 20:52841045-52841067 AAGAATAAGGAAGAGGAGAGGGG - Intergenic
1174730052 20:52907286-52907308 AATGATAAAAAGAAGGAGAGTGG + Intergenic
1174753213 20:53132639-53132661 GAGAATGGAGAGAAAGAGAGGGG - Intronic
1174801476 20:53566512-53566534 TAGAAAAAAGAAAAAGAGTGTGG + Intergenic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1175065311 20:56279619-56279641 AAGAAAAATGAAAAGGAGAGGGG + Intergenic
1175318892 20:58071582-58071604 TGGAAGAAAGTGAGGGAGAGAGG - Intergenic
1175815937 20:61883256-61883278 TAGAAAACACAGCAGGAGAGAGG - Intronic
1175921265 20:62451540-62451562 GAGAAGAGAGAGAAGGAGAGAGG + Intergenic
1176219261 20:63962295-63962317 AAGAATGAAGTGAAGGAGAAAGG - Exonic
1177013895 21:15760280-15760302 TAGGATAAAGAGAAGGGCAAAGG - Intronic
1177097137 21:16849874-16849896 TAGAAAATAGAGAAGGCAAGGGG - Intergenic
1177126319 21:17197850-17197872 AAGAAGAAAGAGAGAGAGAGAGG + Intergenic
1177236674 21:18399490-18399512 TAGAATACAAAGAAGGACTGAGG + Intronic
1177345596 21:19864726-19864748 ATGAATAAAGACAAGGAGAGTGG + Intergenic
1177444676 21:21177709-21177731 GGGAAAAAAGAGAAGGAGAGGGG - Intronic
1177605158 21:23368384-23368406 TAGAATACTGTGAAGGAGATTGG - Intergenic
1177759834 21:25390938-25390960 TAGAATGAAGAGGAGGAGACTGG - Intergenic
1177809244 21:25907134-25907156 TAGAAGAAGAAGAAGAAGAGCGG - Intronic
1178043935 21:28673065-28673087 GAGAAGAGAGAGAAAGAGAGAGG + Intergenic
1178143464 21:29710880-29710902 AAGAAGAAAGGGAAGGAGGGTGG - Intronic
1178170897 21:30038771-30038793 AAAAATAAAGAGAAGAAGATGGG + Intergenic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1178481590 21:32983982-32984004 GAGATGAAAGAGGAGGAGAGAGG + Intergenic
1178484761 21:33011913-33011935 AAGAAGAGAGAGGAGGAGAGAGG - Intergenic
1178676861 21:34638508-34638530 AAAAATAAAAAGGAGGAGAGAGG + Intergenic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1179338964 21:40486484-40486506 AAGAGGAAAGGGAAGGAGAGAGG + Intronic
1179439841 21:41385709-41385731 GGGAATAGAGAGAGGGAGAGAGG + Intronic
1180649651 22:17368168-17368190 CATAATAAAGTGAGGGAGAGTGG + Intronic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181742517 22:24932770-24932792 TAGAAGCACGAGATGGAGAGAGG - Intergenic
1181915665 22:26277984-26278006 TAGAAGAGAGGGAAAGAGAGAGG + Intronic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182173820 22:28262111-28262133 AATAACAAAGAGAAGGAGAAGGG + Intronic
1182222188 22:28767472-28767494 TGGCAGAAAGAGAAGGAGAGAGG - Intergenic
1182738296 22:32546868-32546890 AAGGAGAGAGAGAAGGAGAGAGG - Intronic
1182933802 22:34200903-34200925 TGTAATAAAGAGAAGGGGAATGG - Intergenic
1183091078 22:35522581-35522603 AAGAAGAAAGAAAAAGAGAGAGG - Intergenic
1183104700 22:35607516-35607538 TGGAATAAAGAGAAGGTAGGAGG - Intronic
1183151782 22:36043374-36043396 TTGAATTCAGAGAAGCAGAGAGG + Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183228007 22:36563482-36563504 TTGAGGAAAGGGAAGGAGAGGGG - Intergenic
1183771144 22:39927080-39927102 TGAAAAAAAGAGAAGAAGAGGGG - Intronic
1184082080 22:42229314-42229336 AATAAAAAAGGGAAGGAGAGAGG + Intronic
1184416289 22:44353620-44353642 GAGAATAGAGAGGGGGAGAGGGG - Intergenic
1184722297 22:46322090-46322112 AAAAAAAAAGAGCAGGAGAGAGG + Intronic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
1184994998 22:48199160-48199182 GAGAATAAAGAGTGGGGGAGGGG + Intergenic
1185037056 22:48484875-48484897 GAGAAGGAAGAGAAGGAGGGAGG - Intergenic
1185269096 22:49920289-49920311 AAGAATCATGAGAAGAAGAGGGG - Intronic
1185351490 22:50341996-50342018 AAAAAAAAAGAGGAGGAGAGGGG + Intergenic
949130603 3:495709-495731 TAGAATCAAGCAAAGGAGGGAGG + Intergenic
949494615 3:4619837-4619859 GAGAAAAGAGAGAAGGAGAGGGG - Intronic
949567239 3:5256265-5256287 GAGAAAAAAGAGAAGGAGAAGGG - Intergenic
949870916 3:8587775-8587797 TAGATTAAGGCCAAGGAGAGAGG - Intergenic
949880577 3:8657710-8657732 TAGAAGGAAGGGAAGGAGGGAGG + Intronic
949891504 3:8736991-8737013 AAGAAAAGAAAGAAGGAGAGAGG + Intronic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950018891 3:9772481-9772503 AAAAATCAAGACAAGGAGAGAGG - Intronic
950635522 3:14311697-14311719 TAGAAGGAAGAAAGGGAGAGGGG - Intergenic
950664237 3:14485534-14485556 TGGAAGAAATAGCAGGAGAGAGG + Exonic
950835648 3:15916463-15916485 TAGAATAGAGAGTAGAATAGTGG + Intergenic
950887675 3:16375253-16375275 TAGGAGAAAGATTAGGAGAGAGG + Intronic
951127710 3:19003457-19003479 TCAAAAAAAGAGATGGAGAGTGG - Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951338809 3:21458517-21458539 TAGAAGAAAGGGAAGGGGAGGGG + Intronic
951682213 3:25306519-25306541 TAGAAGAAAAAGAAGAAGAAAGG + Intronic
951987797 3:28640300-28640322 TAAAATAAAAAGATGGAGAAGGG - Intergenic
952106272 3:30073319-30073341 TAGAATAAAGTGAAGAAAGGTGG - Intergenic
952108434 3:30095208-30095230 TAGAAAAATGAGCAGGAGATAGG + Intergenic
952261481 3:31744559-31744581 AAGAAAGAAAAGAAGGAGAGTGG + Intronic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952985870 3:38782458-38782480 AAGAACAAAGAGAAAGAGAATGG - Intronic
953244760 3:41180766-41180788 TCAAAGAAAGAGAAGGAAAGAGG + Intergenic
953423380 3:42772513-42772535 AAGAAGAAAGAGAAGGAGAGGGG - Intronic
953441153 3:42918636-42918658 TAGAATAAGGATAAGGATAAGGG + Intronic
953631676 3:44623350-44623372 AAGAACAAAGAGAAGGTTAGAGG + Intronic
953744802 3:45566218-45566240 TACAGAATAGAGAAGGAGAGAGG - Intronic
953867070 3:46593370-46593392 TAAAAGGAAGAGAGGGAGAGAGG + Intronic
954096739 3:48334672-48334694 AAGAAAAAAGGGAAAGAGAGAGG - Intergenic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955445093 3:59001401-59001423 GAGGAGAGAGAGAAGGAGAGAGG - Intronic
955646952 3:61150039-61150061 TTGAATGAAGAAAAGGACAGGGG - Intronic
955719682 3:61867694-61867716 TATAAAGAAGAGAGGGAGAGAGG - Intronic
956008140 3:64802318-64802340 TAGGACAAGGAGAGGGAGAGAGG - Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956576409 3:70757311-70757333 TTGGATAGAGAGTAGGAGAGTGG + Intergenic
956953035 3:74304296-74304318 TAGGAGAAGGAGAGGGAGAGAGG - Intronic
956971535 3:74532027-74532049 AGGGATAAAGAGAGGGAGAGAGG + Intergenic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
957579318 3:82050374-82050396 GAGAATAATTAGAAGCAGAGGGG + Intergenic
957631924 3:82727153-82727175 TGGAATAGAGAGAAAAAGAGGGG + Intergenic
957652163 3:83021817-83021839 AAGAAGAAAGAGAAGAAGAATGG - Intergenic
957748293 3:84374651-84374673 AAGAAGGAAGAGGAGGAGAGGGG + Intergenic
958146038 3:89626233-89626255 TAGAATAAAGATCAAGAGATTGG + Intergenic
958479422 3:94627871-94627893 AGGAAGAAAGAGAAGGAGAGAGG - Intergenic
958851914 3:99337405-99337427 TAGAAGAAAGAGAAGAGAAGAGG + Intergenic
959282206 3:104358680-104358702 AAGAAGGAAGAGAGGGAGAGAGG - Intergenic
959445732 3:106436356-106436378 AAGAAGAGAGAGAAGGAGGGAGG + Intergenic
959628128 3:108476530-108476552 TAGAAGAAAAGGAAGGAGAGAGG + Intronic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960315687 3:116173752-116173774 TAGAAGAAATAGAAGAAGAGGGG + Intronic
960320985 3:116235474-116235496 AAGGAGAAAGGGAAGGAGAGAGG + Intronic
960538758 3:118842377-118842399 CAGAAAAAAGAAAAGGGGAGGGG + Intergenic
960883231 3:122367134-122367156 AAGGATGAAGAGAAGGAGAGAGG + Intronic
960883236 3:122367157-122367179 GAGGGTGAAGAGAAGGAGAGAGG + Intronic
960967117 3:123113015-123113037 ATTAATAAAGAGAAGGAGCGAGG - Intronic
961837413 3:129674530-129674552 TGAAAGAAAGGGAAGGAGAGAGG + Intronic
961914209 3:130354093-130354115 AAGAAGAAAGAGAAAGAAAGGGG + Intronic
962227626 3:133628810-133628832 AAAAAGAAAGAGGAGGAGAGAGG + Intronic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
962336587 3:134537286-134537308 TAAAATAATGAGAAGCAGATAGG + Intronic
962495781 3:135937657-135937679 TAGAATTAAGAGAAGGAAAAAGG + Intergenic
962526267 3:136240513-136240535 TAAAAGAAAAAGAAGAAGAGAGG + Intergenic
962633199 3:137300779-137300801 TAGAAAACAGAGAAGGAGATGGG + Intergenic
962653580 3:137519837-137519859 GAGAATAATGCGAAGGAGAGAGG + Intergenic
962661879 3:137609925-137609947 GAAAAAAAAGAGAATGAGAGTGG - Intergenic
962714826 3:138116812-138116834 TGGAAAAAAGAGAAAGAGGGAGG - Intergenic
962748542 3:138416086-138416108 AAGAACAAAGAGAAGGTTAGAGG + Intergenic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963603845 3:147397896-147397918 TAGAGGAAAGAGAGGGGGAGGGG - Intronic
963755540 3:149231752-149231774 TACAGGAAAGAGAAGGGGAGAGG + Intergenic
963763072 3:149304978-149305000 GAAAATAAAGAGATGGAAAGAGG - Intergenic
963863623 3:150336219-150336241 TAGAGAAAGGGGAAGGAGAGTGG - Intergenic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
964016930 3:151959145-151959167 TAGAATAAAGAGTAGAAAGGAGG + Intergenic
964073357 3:152663239-152663261 CAGAACAAAGAGAAGGTAAGAGG + Intergenic
964120700 3:153180310-153180332 GAGAATAAAGGGAGGGAGGGAGG - Intergenic
964130842 3:153284724-153284746 AAGAATAAAGAGTAGCAGAGAGG - Intergenic
964419275 3:156484362-156484384 AAGAAAAAAGAGAGAGAGAGAGG + Intronic
964964950 3:162481272-162481294 CAGAATAGAGAGAGAGAGAGAGG - Intergenic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965641607 3:170834735-170834757 CAGAATAAAGAGGAGGACAATGG + Intronic
965730392 3:171765557-171765579 TATTATAAAGAGCAGCAGAGGGG + Intronic
965802754 3:172511527-172511549 GAGAACACAGAGAAGGAGAATGG + Intronic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
965906455 3:173713221-173713243 AAGAATAAAGAAAAGGAGTTAGG + Intronic
965935624 3:174106862-174106884 TAGAAGAAAAAAAAGGAGAAAGG - Intronic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966270322 3:178097022-178097044 AGGAATGAAGGGAAGGAGAGAGG + Intergenic
966278931 3:178207905-178207927 CAGAACAAAGAGCAGGACAGGGG + Intergenic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
966585908 3:181624227-181624249 GAGAAGGAAGAGAGGGAGAGCGG - Intergenic
966592348 3:181696532-181696554 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966959148 3:184916010-184916032 AGGAAGAGAGAGAAGGAGAGAGG - Intronic
966998788 3:185311677-185311699 TAGCCAAATGAGAAGGAGAGGGG - Intronic
967040366 3:185686384-185686406 TAAAAAAAAAAAAAGGAGAGGGG + Intronic
967130914 3:186469905-186469927 AAGAATAAAGTAAAAGAGAGAGG - Intergenic
967149878 3:186638744-186638766 CAGAACAAAGAGGAGGAGAATGG - Intronic
967355410 3:188564439-188564461 TAAATAAAAGAGAAGGATAGGGG - Intronic
967427057 3:189339433-189339455 TAGCATGTAGAGAAGGGGAGGGG - Intergenic
967478416 3:189946876-189946898 GGGAATAAAGAGGAGGAAAGTGG + Intergenic
967512959 3:190334389-190334411 TGGAATAAAGAGACTGAGAAGGG + Intronic
967553346 3:190825753-190825775 TGGAAAAAAGAAAAGGAAAGGGG - Intergenic
967597052 3:191338379-191338401 TAGAAGAAAGAGAAAGATAGGGG + Intronic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
967748492 3:193086525-193086547 TAGAATAAAAAGGTTGAGAGTGG + Intergenic
967992560 3:195142390-195142412 TGGAAGAAAAGGAAGGAGAGGGG - Intronic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
968527049 4:1065463-1065485 AAGAAAAAAGAAAACGAGAGAGG - Intronic
969128967 4:4976943-4976965 ATGAATAAAGAGCATGAGAGAGG - Intergenic
969187435 4:5486830-5486852 AAGAACAAAGAGAAGGTTAGAGG + Intronic
970264542 4:14266820-14266842 TAAGATAATGAGAAAGAGAGTGG - Intergenic
970376780 4:15466658-15466680 TACAATAATCAGATGGAGAGTGG - Intergenic
970500598 4:16672899-16672921 GAGAAAAAAGATAAGGAGAGGGG - Intronic
970852970 4:20623806-20623828 CAGAATAGAGAGAAAGAAAGGGG + Intergenic
970865786 4:20757159-20757181 TGGCATAAAGAGATGAAGAGAGG - Intronic
971042824 4:22773668-22773690 GAGAATGAAGTGAAGGAGAGGGG + Intergenic
972300736 4:37783395-37783417 GAGAAAGAAGAGAATGAGAGAGG - Intergenic
972688190 4:41371176-41371198 ATGAAGAGAGAGAAGGAGAGAGG - Intronic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
972798591 4:42448379-42448401 GAAAAGAAAGAGAAGGAGGGAGG - Intronic
972994171 4:44859501-44859523 AAGAACAAAGAGAAAGTGAGAGG - Intergenic
973129316 4:46630590-46630612 GAGAGTGAAGAGTAGGAGAGTGG - Intergenic
973595930 4:52490164-52490186 AAGAAGAAAGAGAAAGAAAGAGG + Intergenic
973657462 4:53063979-53064001 AAGAAGGAAGGGAAGGAGAGAGG - Intronic
973767218 4:54173616-54173638 GCGAAAAAAGAGAAGAAGAGAGG + Intronic
974441446 4:61923627-61923649 TGGAATGAAGAGAAGGAGAAAGG - Intronic
974512827 4:62866957-62866979 TAGAACAAAGAGAAGGAGCAAGG + Intergenic
974705951 4:65515875-65515897 TAGAACAAAAAGGAGGAGAAAGG + Intronic
974782124 4:66565799-66565821 TTCAGTAAAGAGAAGGATAGGGG + Intergenic
974833984 4:67224566-67224588 GTGAATATAAAGAAGGAGAGTGG + Intergenic
974902254 4:68015107-68015129 TATAATTATGAGAAGTAGAGGGG + Intergenic
975382125 4:73713078-73713100 AAGAATAGCTAGAAGGAGAGAGG + Intergenic
976070406 4:81233796-81233818 GACCATAAAGAGAAGGGGAGGGG + Intergenic
976160155 4:82190495-82190517 AAGAAGAAAGAGAAGAAGAATGG + Intergenic
976392222 4:84517475-84517497 TAGAATAAGGATAAAGAGAGGGG - Intergenic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
976500164 4:85778677-85778699 TTGAAGAAAGAGACAGAGAGGGG - Intronic
976975606 4:91162996-91163018 CACAATAAAAAGAAGTAGAGAGG - Intronic
977126334 4:93173429-93173451 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
977275078 4:94967468-94967490 AGAAAGAAAGAGAAGGAGAGAGG - Intronic
977409001 4:96637336-96637358 TAGAAGAAAAAGAAGAAGAAAGG + Intergenic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
977742890 4:100507784-100507806 TAGAAAAAAGACTTGGAGAGAGG - Intronic
977880640 4:102200913-102200935 TGGAATATAGAAAAGGAGAGGGG - Intergenic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
978293530 4:107175496-107175518 GAAAATAGAGAGAAGGAGAGAGG - Intronic
978349231 4:107803837-107803859 TATAAGAAAGAAAAGAAGAGCGG - Intergenic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978818976 4:112943348-112943370 TAGAAAGAAGGGATGGAGAGAGG - Intronic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
979013993 4:115408552-115408574 AAGAAAAAAAAGAATGAGAGTGG - Intergenic
979121063 4:116902267-116902289 GAGATAAGAGAGAAGGAGAGAGG + Intergenic
979624377 4:122828298-122828320 TAGAGGAAAGAGAAAGAAAGGGG + Intronic
979646228 4:123073214-123073236 AAGAAGAAAGAAAAGGAGATAGG - Intronic
980161239 4:129165842-129165864 TAGAATAGAGAAAAGAACAGAGG + Intergenic
980222761 4:129940929-129940951 CATTATAAAGAGAAGGAGAAGGG - Intergenic
980289230 4:130824359-130824381 TAGAGAAAAGAGAGGGAGGGAGG - Intergenic
980380157 4:132003364-132003386 CACAAGAAAGAGAAAGAGAGAGG + Intergenic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
980535995 4:134124468-134124490 AAGAACAAAGAGAAGGTTAGAGG - Intergenic
980719099 4:136670031-136670053 TTAAATATAGAGAAAGAGAGAGG + Intergenic
980807622 4:137833811-137833833 TAGAATAAAAAGGTGGAGAAAGG - Intergenic
980841045 4:138261766-138261788 GAAAATAAAGAAAAGAAGAGAGG + Intergenic
981036968 4:140181109-140181131 TAGAATAAAGGGAATGTGATTGG + Intergenic
981041900 4:140230866-140230888 TAGAACAAAAAGGAGGAGAAAGG - Intergenic
981172724 4:141643569-141643591 GAAAATAAGGAGAAGGGGAGTGG - Intronic
981567529 4:146116268-146116290 GAGGATAAAGAGAAAGGGAGTGG + Intergenic
981599144 4:146465978-146466000 TAGAAAATACAGAAGGAAAGAGG - Intronic
981786597 4:148486609-148486631 TAAAGGAAAGAGAAGGAGACAGG - Intergenic
981921975 4:150095818-150095840 TGGAAGAGAGACAAGGAGAGAGG + Intronic
981960226 4:150528600-150528622 TAAAATAAAAAAAGGGAGAGGGG - Intronic
981966968 4:150615605-150615627 GAGAAAAAAGAGAATGTGAGAGG + Intronic
982683211 4:158457886-158457908 TAGAAGACAGAGAAAGAGATAGG - Intronic
982792131 4:159605374-159605396 TAAAAAAAAGAGAAGTAGGGTGG + Intergenic
983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG + Intergenic
983168083 4:164502632-164502654 AAGAATAAAGAAAGTGAGAGAGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983486524 4:168338053-168338075 GAGCATAGAGAGAAGGAGATGGG - Intergenic
984315868 4:178130377-178130399 TAGAATGAAGACATGGAGAAGGG + Intergenic
984606727 4:181794471-181794493 TAGAATAGAGAGTAGAAGGGCGG - Intergenic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
984767064 4:183407869-183407891 AAGAAGAAAGAGAAAGAAAGAGG - Intergenic
984816961 4:183847947-183847969 TGGTATAAAGAGAACTAGAGAGG + Intergenic
984908780 4:184652849-184652871 AAGAAAAAAGAAAAGGAGGGAGG + Intronic
985166160 4:187096821-187096843 TAGAATACAGATAAGTAGAAAGG - Intergenic
985202992 4:187504068-187504090 AAGAAGAGAGAGGAGGAGAGGGG - Intergenic
985321207 4:188713410-188713432 TAGGAGAAAGAGATGGAGATGGG - Intergenic
985365513 4:189227490-189227512 AAGACTAAAGAGAATGGGAGAGG - Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985832693 5:2246543-2246565 TAAAATAAAGATATGGAGATAGG - Intergenic
985909221 5:2865967-2865989 AAGAAAGAAGAGGAGGAGAGTGG + Intergenic
986067061 5:4245124-4245146 GAGAAGAAAGAGAAGGAAAACGG - Intergenic
986091905 5:4516942-4516964 AAGAAGGAAGAGAAGGAGTGGGG - Intergenic
986150799 5:5128999-5129021 CAGAAGAAAGAGAGAGAGAGGGG - Intergenic
986232176 5:5876254-5876276 TAGAAAACAGAGAAAGAGATAGG - Intergenic
986360657 5:6975121-6975143 TAGGAGAAAGAGAGGGAGGGAGG + Intergenic
986776773 5:11022633-11022655 GAGAATCAAGAGAAGGAAAATGG - Intronic
987120137 5:14759769-14759791 AAGAAAAAAGAAGAGGAGAGGGG + Intronic
987581152 5:19794341-19794363 TAGAAGAAAAAGATGGAGAAAGG + Intronic
988181021 5:27793875-27793897 TAGAAAAAAGAAAAGGAGTTAGG + Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988532394 5:32039107-32039129 TAGAAAGGAGAGAGGGAGAGGGG - Intronic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
989034600 5:37156780-37156802 TACAAGACAGAGAAGGAGGGAGG + Intronic
989073365 5:37535156-37535178 AACGATAAAGAGTAGGAGAGAGG + Intronic
989208184 5:38832073-38832095 GAGGAGAGAGAGAAGGAGAGAGG - Intergenic
989208190 5:38832169-38832191 GAGGAGAGAGAGAAGGAGAGAGG - Intergenic
989426639 5:41303630-41303652 TAGATGAGAGAGAGGGAGAGGGG + Intergenic
989813257 5:45704098-45704120 AAGAACAAAGATAAAGAGAGGGG - Intergenic
990006782 5:50953622-50953644 AAGAAAGAAGAGAAGGGGAGAGG - Intergenic
990319685 5:54617717-54617739 TAAAAAAAAGAAAAAGAGAGAGG - Intergenic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
991227876 5:64293264-64293286 AAGAATGAAGAAAAGCAGAGTGG - Intronic
991444297 5:66682979-66683001 TAGAATAAAGGGCAGGCGAAGGG + Intronic
991901551 5:71465557-71465579 TAAAATAAAGAGAAACAGACAGG - Intronic
992127646 5:73658233-73658255 TAGAGTAAAGAGAAGAAATGGGG - Intronic
993040124 5:82804904-82804926 CAGAATGAAAAAAAGGAGAGGGG + Intergenic
993579796 5:89646155-89646177 CAAAATAAAGTGAAGGAGGGGGG - Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
993820764 5:92613510-92613532 TAGAATAAAAAGAATGAGTGGGG + Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994226391 5:97255764-97255786 GAGTATATAGAGAAGGAGATGGG + Intergenic
994248051 5:97503592-97503614 TAGAAGGAAGAGAAGGCAAGGGG - Intergenic
994333782 5:98539835-98539857 TAAAAGAGAGAGATGGAGAGAGG + Intergenic
994608131 5:101997240-101997262 AAGAAGAAAGAGAAGAAGAAGGG + Intergenic
994741146 5:103620915-103620937 AAGAATATTAAGAAGGAGAGTGG - Intergenic
994827865 5:104739094-104739116 TAAAATACAGAGAAGGAAAAAGG + Intergenic
994934674 5:106239014-106239036 AAGAAAAAAGAGAAGGAAAAAGG + Intergenic
995099461 5:108280906-108280928 CAGTAAAAAGAGAAAGAGAGAGG + Intronic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
995554103 5:113309933-113309955 CAGAAGAAAGAGAGGAAGAGAGG - Intronic
995649892 5:114358684-114358706 GAGTACAGAGAGAAGGAGAGAGG - Intergenic
995862458 5:116655830-116655852 TGGAATAAAGAGAGTGAAAGAGG - Intergenic
995926547 5:117381811-117381833 GAGAAGAAAGAAAAAGAGAGAGG - Intergenic
996051127 5:118935027-118935049 AAGACTAAGGGGAAGGAGAGAGG + Intronic
996074528 5:119174781-119174803 TAGAGGAAAGAGAAAGAGAAAGG - Intronic
996100259 5:119437936-119437958 AAGAAGAGAGAGAAAGAGAGAGG + Intergenic
996156319 5:120107175-120107197 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
996486959 5:124047088-124047110 TAGAGTGAAGAGAAAGAGAGAGG + Intergenic
996971356 5:129372202-129372224 TGGAATAAAGAGAAGGGAAATGG + Intergenic
997419950 5:133758382-133758404 AAGAATAAACATAAGGAAAGTGG + Intergenic
997655639 5:135552290-135552312 GAAAATAAACTGAAGGAGAGCGG + Intergenic
998484203 5:142487397-142487419 TGGAGTGATGAGAAGGAGAGCGG + Intergenic
998713728 5:144856458-144856480 TGGAAGAGAGAGAGGGAGAGTGG - Intergenic
998786433 5:145714826-145714848 TAGAAAGAAGAGCAGGAAAGAGG - Intronic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999252657 5:150191810-150191832 GAGAGGGAAGAGAAGGAGAGTGG - Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999628319 5:153543590-153543612 AGGAAGAAAGAGAAGGAGTGAGG + Intronic
999811158 5:155128631-155128653 TAAGATACAGAGAAAGAGAGTGG + Intergenic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
999928598 5:156406434-156406456 CAAAATAAAGAGAAGAGGAGAGG - Intronic
1000152169 5:158513964-158513986 AGGGAGAAAGAGAAGGAGAGAGG + Intergenic
1000256463 5:159543412-159543434 GAAAATAAAGAGAAGGAGTGGGG + Intergenic
1000287586 5:159840110-159840132 GAGAGTCAAGAGATGGAGAGGGG - Intergenic
1000388513 5:160699101-160699123 TAGAATAAAGGGAAGAAAATGGG - Intronic
1000408355 5:160912652-160912674 GAGAAAAAAGAGAAGAAAAGAGG + Intergenic
1000464926 5:161564007-161564029 TAAAACAAACAGAAGGAGAGAGG - Intronic
1000570122 5:162901680-162901702 TAAAAGTAAGAGAAAGAGAGAGG - Intergenic
1000962507 5:167616656-167616678 AGGAAGAGAGAGAAGGAGAGAGG + Intronic
1001044709 5:168362936-168362958 TAGAAAAAAGAAGAGGAGGGAGG - Intronic
1001154606 5:169262300-169262322 GAGAATAAAGATATGGTGAGAGG + Intronic
1001241944 5:170077891-170077913 GAGAAGAGAGAGAAGGAGGGGGG - Intronic
1001298100 5:170513272-170513294 TAGAATCCAGAGAAGGTGAGTGG + Intronic
1001667619 5:173446476-173446498 TGGATTTAAGAGAATGAGAGGGG + Intergenic
1001861859 5:175062831-175062853 AAGAAAAAAAAAAAGGAGAGGGG - Intergenic
1001919452 5:175588783-175588805 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1001976220 5:176001603-176001625 AAGAACAAAGAGAAGGTTAGAGG - Intronic
1002030059 5:176421525-176421547 TAAAATAACGACAGGGAGAGTGG - Intergenic
1002241203 5:177842168-177842190 AAGAACAAAGAGAAGGTTAGAGG + Intergenic
1002899508 6:1399259-1399281 GAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1003004584 6:2369121-2369143 TAGCAGGAAGAGAAAGAGAGAGG + Intergenic
1003022889 6:2527377-2527399 TTGAAGAAAAATAAGGAGAGAGG - Intergenic
1003158281 6:3614978-3615000 TCGAAGAAAGGGAAGGGGAGGGG + Intergenic
1003311739 6:4974949-4974971 TAAAGTAAAGGGAAGAAGAGAGG - Intergenic
1003376236 6:5580298-5580320 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1003380407 6:5619805-5619827 AAGAATGAAGAGAGGGAGACAGG - Intronic
1003435926 6:6088021-6088043 GAGAAGAAAGAGAGGGAGAAGGG + Intergenic
1003517255 6:6827426-6827448 GGGAAAAGAGAGAAGGAGAGAGG + Intergenic
1003941886 6:11036944-11036966 GAGGAGAGAGAGAAGGAGAGGGG + Intronic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004558973 6:16728905-16728927 AGGAATAAATAGAAGGAGAATGG - Intronic
1004649185 6:17592135-17592157 AAGAATCAAAAGAATGAGAGAGG + Intergenic
1004725623 6:18308803-18308825 GGGAAGAAAGAGAAGGAGAGAGG - Intergenic
1004789757 6:19011746-19011768 TAGAAAAGAGAGAAGGCTAGAGG - Intergenic
1004862162 6:19815925-19815947 AGGAATGAAGAAAAGGAGAGAGG + Intergenic
1005578224 6:27209941-27209963 TAGAAAAAAAAGAGAGAGAGAGG - Intergenic
1005771828 6:29081495-29081517 GAAAAGAAAGAGAAAGAGAGAGG - Intergenic
1005816962 6:29561306-29561328 AAGAGTAAAGAGAGAGAGAGAGG - Intronic
1005850767 6:29819055-29819077 GAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1005865806 6:29935136-29935158 GAGAAGAAAGAGATGGAGGGAGG - Intergenic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006289814 6:33126092-33126114 TAGAATAAAGAAAAACACAGGGG + Intergenic
1006348127 6:33499738-33499760 GAGAATAGAGAGAAGATGAGTGG - Intergenic
1006745507 6:36339207-36339229 CACAATAAAAAGAAGGGGAGGGG + Intergenic
1006936859 6:37724573-37724595 TAGAACAGAGAGAGGGAGGGAGG + Intergenic
1007014310 6:38448288-38448310 TAAAAGAAAGAGAAGGAGAGGGG + Intronic
1008288407 6:49682790-49682812 AAGGAGGAAGAGAAGGAGAGAGG - Intergenic
1008373795 6:50768307-50768329 GAGAAAAAAGAAAAGGAGAGAGG - Intronic
1008419333 6:51279103-51279125 AGGAATAAAGTGAAGGGGAGGGG + Intergenic
1008424621 6:51342687-51342709 TATAATAAAGAGATGGAAGGAGG + Intergenic
1009227494 6:61032488-61032510 TATAATAATCAGAAGGAAAGAGG - Intergenic
1009635555 6:66259982-66260004 TAGGAGAAGGGGAAGGAGAGGGG + Intergenic
1009667244 6:66699811-66699833 TACAATCAAGTGAAGGATAGAGG - Intergenic
1009865081 6:69387292-69387314 TTGATTGAAGAGAAGCAGAGAGG + Intronic
1009901963 6:69818709-69818731 TAGTAAACAGAGAAGGAGAAAGG + Intergenic
1009932598 6:70194033-70194055 TAAGAAAAAGAGAAGGAGACGGG - Intronic
1010526643 6:76907758-76907780 AACCATAAAGAGAAAGAGAGAGG - Intergenic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011082743 6:83507715-83507737 TATAAGAAAGAGAAGGAGCTGGG + Intergenic
1011106336 6:83785846-83785868 GAGAAGGGAGAGAAGGAGAGAGG + Intergenic
1011621661 6:89249320-89249342 TAGAAGAAAGAGATGAGGAGAGG - Intergenic
1011743336 6:90385367-90385389 TACAGAAAAGAGAAGGTGAGAGG - Intergenic
1011744730 6:90398503-90398525 TAGAAGCAAGAGCATGAGAGAGG - Intergenic
1011838141 6:91458990-91459012 TAGGAAAAAGACAAGAAGAGAGG + Intergenic
1011895087 6:92215668-92215690 TAGAATAAATAGGCAGAGAGAGG - Intergenic
1011952150 6:92979845-92979867 TAGACTAAAGACAGAGAGAGAGG - Intergenic
1012335304 6:98047983-98048005 TAAAAGAAAGAGAGAGAGAGAGG - Intergenic
1012575032 6:100784819-100784841 TAAAATAAACAAAAGGAGAAAGG + Intronic
1012638681 6:101580986-101581008 TAAAATATAGAGGATGAGAGAGG - Intronic
1012734306 6:102919677-102919699 AGGAAGAAAGGGAAGGAGAGAGG + Intergenic
1013284886 6:108672744-108672766 AAGAAGAAAGAGGATGAGAGAGG - Intronic
1013348174 6:109282414-109282436 TAGAAAGAAGAGAAGAGGAGGGG - Intergenic
1013423347 6:109986936-109986958 TAGAATGAAGAAAAGGAAAAGGG + Intergenic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1013821366 6:114157082-114157104 CAGAAGGAAGAGAAGGTGAGGGG - Intronic
1014066725 6:117135578-117135600 TAAAAAAAAGAGAGAGAGAGAGG + Intergenic
1014177768 6:118349012-118349034 CAGAAGGAAGAGAGGGAGAGAGG - Intergenic
1015064775 6:129011206-129011228 GAGCAAAAAGAGAAGGAGAGAGG - Intronic
1015422538 6:133026981-133027003 TAGGAAAGAGAAAAGGAGAGAGG - Intergenic
1015550018 6:134402538-134402560 TAGAAGAAAGAGAAAAAGACAGG - Intergenic
1015645251 6:135380035-135380057 AAGAAGAAAGAGAGGGAGGGAGG - Intronic
1015752349 6:136573205-136573227 TAGAACAAAAAGATGGAGAAAGG + Intronic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1015878083 6:137844451-137844473 TTGAAGAAAGAGGAGGAGTGTGG + Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016395296 6:143617592-143617614 AAGAAAAGAGAGAAAGAGAGAGG - Intronic
1016441369 6:144087537-144087559 TAGAAAAAAGGGAAGGAAATTGG + Intergenic
1016562604 6:145413936-145413958 GACAATCTAGAGAAGGAGAGGGG - Intergenic
1016686316 6:146886278-146886300 CACAATGAAGAGAAGAAGAGGGG - Intergenic
1016802644 6:148182353-148182375 TAAAATAAAGAAAAAGAGGGAGG + Intergenic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1017199746 6:151739897-151739919 TGGAAAAAAGGGATGGAGAGAGG - Intronic
1017212206 6:151869269-151869291 TCGAACAGAGTGAAGGAGAGGGG + Intronic
1017822182 6:158057408-158057430 TACAATAAAGGGAAAGAAAGAGG + Intronic
1018251067 6:161871009-161871031 CAGAAGACAGAGAAGGGGAGAGG + Intronic
1018342958 6:162870883-162870905 AAGAAACAAGAGAAGGAGGGAGG - Intronic
1018625669 6:165776661-165776683 AGGAACGAAGAGAAGGAGAGAGG - Intronic
1018911401 6:168102341-168102363 GAGAGCAAAGAGAGGGAGAGAGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019705484 7:2495420-2495442 AAAAAAAAAGAAAAGGAGAGAGG + Intergenic
1019730520 7:2627189-2627211 AAGAAGGAAGGGAAGGAGAGAGG + Intergenic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1020605316 7:10330164-10330186 AAGAACAAAGAGAAGGGAAGTGG - Intergenic
1020832317 7:13108141-13108163 TAGGATGAAGAGTAGGGGAGGGG + Intergenic
1020937088 7:14480107-14480129 CAGAATAGAGAAAGGGAGAGAGG + Intronic
1021034483 7:15780731-15780753 TAGATTAAAGAGAAATAAAGAGG - Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021169207 7:17377558-17377580 TAAAATAAAGATAAAGAGAAGGG - Intergenic
1021226445 7:18033581-18033603 TAAAATAAAAAGAATGAGGGTGG - Intergenic
1021266888 7:18535882-18535904 TACAATAAAGAGGAAGAGAGGGG + Intronic
1022114518 7:27250328-27250350 TAGAGGAAAGAGTAGGAGTGGGG + Intergenic
1022410910 7:30137547-30137569 TAGAATAGATAGAAAGATAGAGG + Intronic
1022510554 7:30932614-30932636 AGGGAGAAAGAGAAGGAGAGAGG + Intergenic
1022516515 7:30978192-30978214 AGGAATAAAGAGAGGGAGAGTGG - Intronic
1022642896 7:32204999-32205021 AAGAAAAAAGGGAAGAAGAGAGG + Intronic
1022825902 7:34013426-34013448 TATAGTACAGAGAAGGAGACTGG - Intronic
1022901173 7:34811965-34811987 GAGAAGAAAGAGAAGGAAAGAGG - Intronic
1023085770 7:36568737-36568759 GAGAAGAAAGAGAAGGGGAGGGG - Intronic
1023410951 7:39888665-39888687 AAGAATAGAGAGAGAGAGAGAGG + Intergenic
1023453727 7:40315550-40315572 AAGAATAAAGTAAAGGAGAATGG + Intronic
1023738867 7:43259860-43259882 TAGAATAATGAGAGAGAGAATGG + Intronic
1023983995 7:45084897-45084919 CAGAAGACAGAGGAGGAGAGCGG - Exonic
1024045015 7:45580131-45580153 TAGACAAAAGAGAGGGAGAATGG + Intronic
1024198441 7:47082723-47082745 TAGAATAAACAGAAGACGAGAGG + Intergenic
1024525813 7:50348320-50348342 AGGAAGAAGGAGAAGGAGAGGGG + Intronic
1024655429 7:51447861-51447883 TAGAATAAGGATAAGGACAAAGG - Intergenic
1024682027 7:51700668-51700690 AAATATAAAGAGAAGGAGAAAGG + Intergenic
1024919896 7:54545375-54545397 AAGGAGAAAGAGACGGAGAGAGG + Intronic
1026137607 7:67677297-67677319 TAGGACAAAGAAAAGGAGACTGG + Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026214817 7:68339009-68339031 TAGGATAGAGAGGAGGAGTGTGG - Intergenic
1026284985 7:68955124-68955146 AAGCAGAAAGAGAAAGAGAGGGG + Intergenic
1026284989 7:68955156-68955178 AACAAGAAAGGGAAGGAGAGAGG + Intergenic
1026311942 7:69193821-69193843 AAGAAGAGAGAGAAAGAGAGAGG + Intergenic
1026520501 7:71113671-71113693 AAGAAAAGAGGGAAGGAGAGAGG - Intergenic
1026697434 7:72607471-72607493 AAGAAGGAAGAGAAGGAGAGAGG + Intronic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027421805 7:78024156-78024178 TAGGATAAAAAGCAGGAGAATGG - Intronic
1027433460 7:78138352-78138374 GAGAAGAAAGAGAAGAGGAGAGG + Intronic
1027437860 7:78184092-78184114 TAAAAACAAGAGAAGGAGAATGG - Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028744687 7:94314571-94314593 TATAATTAAGAGAGTGAGAGAGG - Intergenic
1028977463 7:96930016-96930038 TAGAATAAATAGAGGGAGACAGG - Intergenic
1028980735 7:96965264-96965286 TAGAATACAGAGGGGGAAAGGGG - Intergenic
1029051516 7:97693892-97693914 TAGAGTAAATAGGAAGAGAGGGG + Intergenic
1029097762 7:98102687-98102709 TAAAATAAAGAAAAGGAAAATGG - Intergenic
1029348632 7:99997229-99997251 AAGAAGAGAGGGAAGGAGAGAGG - Intergenic
1029542336 7:101191232-101191254 GAGAAAAAGGAGCAGGAGAGAGG + Intergenic
1029918607 7:104238318-104238340 GATAATAAAGAGACAGAGAGAGG + Intergenic
1030098972 7:105927971-105927993 TAAAATACAGAGAACCAGAGCGG + Intronic
1030217005 7:107054465-107054487 TAGCAGAAAGACAGGGAGAGGGG - Intronic
1030364409 7:108629233-108629255 TGGAAGAAAGAGCATGAGAGAGG - Intergenic
1030503863 7:110395164-110395186 TGGAAGAAAGAGAAGGAGGGAGG + Intergenic
1030814891 7:114023642-114023664 TAGAATATAGAAAAGGAGCTTGG - Intronic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1030875715 7:114810755-114810777 TGGAAGAAAGTGAAGTAGAGAGG - Intergenic
1030952750 7:115812384-115812406 TTGAATTCAGAGGAGGAGAGGGG + Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031626713 7:124000709-124000731 CAGAAAGAAGAGAGGGAGAGAGG + Intergenic
1031654209 7:124332249-124332271 GAGAGGGAAGAGAAGGAGAGAGG + Intergenic
1031949362 7:127876117-127876139 AAGGACAAAGAGAAGGAGAGGGG - Intronic
1032252997 7:130273544-130273566 GAAAAAAAAGAGAAGGGGAGGGG - Intronic
1032746765 7:134793918-134793940 TAGAGTAAAGTGAAGGAATGAGG - Intronic
1032891239 7:136197834-136197856 AAGAAGAAAAAGAAGAAGAGAGG + Intergenic
1032933537 7:136702042-136702064 TATAAAATAGATAAGGAGAGGGG + Intergenic
1033350825 7:140560449-140560471 TATCATAAAGAGAGAGAGAGAGG - Intronic
1033452304 7:141472741-141472763 TAGAAGAGAGAGAAGGTAAGTGG - Exonic
1033669125 7:143472906-143472928 GAAAATAGAGAGAAAGAGAGAGG + Intergenic
1033839127 7:145352670-145352692 AAGAACAAAGAGAAGGTTAGAGG + Intergenic
1033984888 7:147213250-147213272 TAGAACAAAGAGACGAAGAGAGG - Intronic
1034210335 7:149357670-149357692 AAGAGAAGAGAGAAGGAGAGAGG - Intergenic
1034392298 7:150796185-150796207 TAGAACAAAGAGAAGGTTAGAGG - Intronic
1036072080 8:5451941-5451963 TAGAATACAGAGAAACACAGAGG - Intergenic
1036250216 8:7155725-7155747 AAGGAGAAAGAGAAGAAGAGTGG + Intergenic
1036367272 8:8131725-8131747 AAGGAGAAAGAGAAGAAGAGTGG - Intergenic
1036628806 8:10496123-10496145 GAGAAGAAAGAGAAGGAAAAAGG + Intergenic
1036883608 8:12533937-12533959 AAGGAGAAAGAGAAGAAGAGTGG + Intergenic
1037145318 8:15564889-15564911 AAGATAGAAGAGAAGGAGAGAGG + Intronic
1037173520 8:15921503-15921525 TAGAATAAAAAGGCAGAGAGAGG - Intergenic
1037407174 8:18555159-18555181 TAGGATGAACGGAAGGAGAGCGG + Intronic
1037483985 8:19330418-19330440 AAGAAGAAAGAGAATGAGATGGG - Intronic
1037630821 8:20654040-20654062 GAGAAGAGAGAGGAGGAGAGAGG - Intergenic
1037645309 8:20787491-20787513 TCAAAAAAAGAGAAGGAAAGAGG + Intergenic
1037648943 8:20819266-20819288 CAACATAAAGAAAAGGAGAGGGG + Intergenic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1037870059 8:22485781-22485803 AAGAACAAAGAGAAGGTTAGAGG + Intronic
1038544354 8:28413627-28413649 AAGAAGAGAGAGAAGGAGAAAGG - Intronic
1038693407 8:29783309-29783331 GGGAATAAAGAGAAAGTGAGTGG - Intergenic
1038750808 8:30294045-30294067 TAGGAGAAAGGGAGGGAGAGGGG + Intergenic
1039118565 8:34119967-34119989 GAGAAAGAAGAGAAGGAGAAGGG - Intergenic
1039407600 8:37326619-37326641 GAGAGGAAAGGGAAGGAGAGGGG - Intergenic
1039971271 8:42323559-42323581 AAGAGCAAAGGGAAGGAGAGAGG + Intronic
1040690969 8:49937956-49937978 TAGGATAAAGAAAAGAAGGGAGG - Intronic
1040758416 8:50808603-50808625 GAGAAGACAGAGAAGGAGAGGGG - Intergenic
1041027828 8:53704634-53704656 TAGATAAAAGACATGGAGAGAGG + Intergenic
1041098130 8:54369853-54369875 GAGAAAAAAGAGAGGGAGGGAGG - Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1041796900 8:61754369-61754391 TAGAATAAAAAAAAAGAAAGGGG - Intergenic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042338968 8:67658890-67658912 CAGACAAAAGAGAATGAGAGAGG - Intronic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1042513109 8:69631664-69631686 TGGAATAAAGAGAAGTTGAGTGG - Intronic
1042648262 8:71011149-71011171 CAGACGAGAGAGAAGGAGAGGGG - Intergenic
1042663027 8:71176788-71176810 GAGAATGGAGGGAAGGAGAGAGG - Intergenic
1042849300 8:73199913-73199935 TATAATAAAGACAGAGAGAGAGG - Intergenic
1042965228 8:74344234-74344256 AAGAATAAAGGGCAGGGGAGGGG - Intronic
1043081757 8:75774989-75775011 TAGAGTACAGAGTAGGGGAGAGG - Intergenic
1043264070 8:78240358-78240380 GGGAAGAAAGAGAAAGAGAGAGG + Intergenic
1043295665 8:78659622-78659644 GAGAACAAAAAGAAGGAGAATGG + Intergenic
1043557993 8:81456325-81456347 TAGAAGAAAGATAATGAAAGAGG - Intergenic
1043570929 8:81601596-81601618 AAGAAAAAAGAAAAGGAAAGTGG + Intergenic
1043585227 8:81760853-81760875 CAGAAGACAGAGAAAGAGAGAGG + Intergenic
1043919579 8:85965757-85965779 TAGCCAAAAGAGAAGGAGATGGG + Intergenic
1044201816 8:89447129-89447151 TAGAAAGAAGAGAAACAGAGAGG - Intergenic
1044335468 8:90979216-90979238 TGGAAGAATGAGAATGAGAGGGG - Intronic
1044365807 8:91343742-91343764 TAGATTAGAAAGAAAGAGAGAGG - Intronic
1044830120 8:96239009-96239031 AAGAATAAGGAAAAGGAAAGTGG - Intergenic
1044892450 8:96851722-96851744 TAGAATAAAGAAAACGAAAGGGG + Intronic
1044904746 8:96989386-96989408 AAGAATGAAAGGAAGGAGAGGGG + Intronic
1045369051 8:101502827-101502849 AAGAAAAAAAAGAAGGAGAAGGG - Intronic
1045628175 8:104082230-104082252 GAGAATTAAAGGAAGGAGAGAGG + Intronic
1045636138 8:104193070-104193092 GAGATTAAAGGGAAGGAGGGAGG - Intronic
1045718666 8:105079655-105079677 TGGAAGAAAGAGAAAGAGGGAGG + Intronic
1045737952 8:105318584-105318606 AAGAAGGAAGAGAAGGAGGGAGG - Intronic
1045773285 8:105770912-105770934 TAGAGGAAAGATAAGGAGATTGG - Intronic
1045821085 8:106338873-106338895 TAAATTAAAGAGAGAGAGAGTGG - Intronic
1045829101 8:106436671-106436693 TACAGTAAAGAGATGAAGAGAGG - Intronic
1045974738 8:108119400-108119422 AAGAAGAAAGAAAGGGAGAGAGG + Intergenic
1046061599 8:109146040-109146062 AAGAAAGAAGGGAAGGAGAGAGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046237795 8:111449392-111449414 TAGGATACAGAGAAGGAGACAGG + Intergenic
1046543099 8:115612099-115612121 TGAAAAAAAGAGAAGGAGAAAGG + Intronic
1046706741 8:117462014-117462036 AAGGAAAAAGAGAAGGAAAGAGG + Intergenic
1046842078 8:118870314-118870336 TGGAATATAGAGAATGAGAAGGG - Intergenic
1047059454 8:121207952-121207974 TATTTTAAAGACAAGGAGAGAGG - Intergenic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047157166 8:122332288-122332310 AAAAAGAAAGAGAAGGAGAGTGG - Intergenic
1047181228 8:122590000-122590022 TAGAAGAAAAAGATAGAGAGTGG + Intergenic
1047304938 8:123645080-123645102 GAGAAGAGAGAGAAGCAGAGAGG + Intergenic
1047425867 8:124746235-124746257 TACATGAAAGAGAAAGAGAGAGG + Intergenic
1047425977 8:124747521-124747543 AAGAAGAAAGAGAGAGAGAGAGG - Intergenic
1047680010 8:127245024-127245046 TAGAAAAAAAAAAAGGAGAGGGG + Intergenic
1047741817 8:127812565-127812587 GAAAAGAAAGAAAAGGAGAGAGG + Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048072590 8:131038577-131038599 TAGAAAAAAAAGGAGGAGAAAGG + Intronic
1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG + Intergenic
1048088356 8:131209460-131209482 TAGAATAGAGAGAATGAGATTGG - Intergenic
1048211850 8:132460883-132460905 TAGAAGATAGGGAAGGAGGGTGG - Intronic
1048520677 8:135151471-135151493 TAAAGGAAAGAGAAGGAGGGAGG + Intergenic
1048904364 8:139073615-139073637 AAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1049397704 8:142409276-142409298 GAGTGAAAAGAGAAGGAGAGAGG + Intergenic
1050013275 9:1207534-1207556 AAGGAGAAAGAGATGGAGAGAGG + Intergenic
1050555120 9:6783162-6783184 TGCAATAAAGGGAAGCAGAGAGG - Intronic
1050892747 9:10845519-10845541 TAGAATAAAGAGCAAAAGAATGG - Intergenic
1050929805 9:11308677-11308699 TAGAATAAAAATAAGGATAAGGG - Intergenic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051657346 9:19395717-19395739 AAGAAGAAAGAGAGAGAGAGAGG - Intergenic
1051868828 9:21713742-21713764 TAGAAGTAAGAGAAGCAAAGGGG + Intergenic
1051922814 9:22287658-22287680 TAGAAGAAAGGGAAGAAGTGGGG - Intergenic
1052099422 9:24426382-24426404 TAGAATATGAAAAAGGAGAGAGG - Intergenic
1052140845 9:24980971-24980993 TATGATAAACGGAAGGAGAGGGG - Intergenic
1052702076 9:31949799-31949821 CAGGATAAAGAGAGAGAGAGGGG + Intergenic
1052822978 9:33153951-33153973 GAGAAGAAAGGGAAGGGGAGGGG + Intronic
1053149754 9:35735924-35735946 TAGAATGAAAAGTAAGAGAGAGG + Intronic
1053280503 9:36817407-36817429 AGAAAGAAAGAGAAGGAGAGAGG + Intergenic
1053348071 9:37392701-37392723 TAGAAGAAAGCGAAGCAGAGAGG + Intergenic
1053724433 9:40984095-40984117 TCTAATAAAGAGTAGAAGAGTGG + Intergenic
1054341533 9:63867865-63867887 TCTAATAAAGAGTAGAAGAGTGG - Intergenic
1054341535 9:63867904-63867926 TCTAATAAAGAGTAGAAGAGTGG - Intergenic
1054735175 9:68743816-68743838 GAGAATCAATAGAAGGACAGGGG - Intronic
1054856809 9:69909223-69909245 TAGAATGTAGAGATGGGGAGTGG + Intergenic
1054908144 9:70428737-70428759 TAGTATAAAGGATAGGAGAGGGG + Intergenic
1055316567 9:75039886-75039908 TACAGGAAAGAGAAGGGGAGGGG - Intergenic
1055366362 9:75548770-75548792 GAAAAGAAAGAGAAAGAGAGAGG - Intergenic
1055462977 9:76536863-76536885 TAGAAAGAAGAGAAAGAGAGAGG + Intergenic
1055503790 9:76927935-76927957 TAGAATAAAGAGAACAGGATTGG - Intergenic
1055618061 9:78093826-78093848 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1055664771 9:78542382-78542404 TTGAAAAAAGAGGAAGAGAGTGG + Intergenic
1055800598 9:80032030-80032052 TAGGAGACAGAGAATGAGAGGGG + Intergenic
1055842794 9:80526232-80526254 GAGAATAAAGAAAAGCATAGCGG + Intergenic
1055901186 9:81239879-81239901 TAGACCAAAGAGCAGGAGATTGG - Intergenic
1055977446 9:81968844-81968866 GAGAAGAAAGAAAAGGAGAAGGG + Intergenic
1056063209 9:82906509-82906531 TAGGAGAAAAAGAAGGAGAAGGG + Intergenic
1056342009 9:85645085-85645107 TAGAAAACAGAGGAAGAGAGAGG - Intronic
1056697632 9:88873382-88873404 AAGAAGAAAGGGAGGGAGAGAGG + Intergenic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1056707665 9:88965828-88965850 GAAAATAAAGGGAAGGGGAGTGG - Intergenic
1057630020 9:96712128-96712150 AAGAACAAAGAGAAGGTTAGAGG + Intergenic
1057752257 9:97802554-97802576 TAGAAGTGAGAGAAGGAGAGAGG + Intergenic
1058047597 9:100373406-100373428 GAGAACAAAGGGAAGGAGTGGGG + Intergenic
1058051035 9:100406829-100406851 TAGTATAAAGAGGTGGAGAAAGG + Intergenic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058197502 9:101996604-101996626 TAGATTAGAGAGAGAGAGAGAGG + Intergenic
1058380898 9:104375968-104375990 TAAAATAAATAAAATGAGAGAGG + Intergenic
1058520271 9:105809219-105809241 CAAAATAGACAGAAGGAGAGAGG + Intergenic
1058569576 9:106326236-106326258 GAGAATCAAGAGAGGGAGGGAGG + Intergenic
1059174395 9:112155870-112155892 AGGAAGAAGGAGAAGGAGAGAGG + Intronic
1059198052 9:112389352-112389374 TAAGATATAGAGAAGGAGAAAGG + Intronic
1059383675 9:113947917-113947939 TAGAAGAATGGGAGGGAGAGGGG + Intronic
1059698981 9:116757066-116757088 TCAAAAAAAGGGAAGGAGAGGGG - Intronic
1059919472 9:119141896-119141918 TAGAATAGAGGCAAGGAGACAGG + Intergenic
1060509312 9:124220667-124220689 TAAAATTCTGAGAAGGAGAGCGG - Intergenic
1060607688 9:124931577-124931599 TCTTATAAAGTGAAGGAGAGAGG + Intronic
1060763434 9:126275303-126275325 CAGAATAAAGAGAAGAGGAGAGG - Intergenic
1061449312 9:130660003-130660025 AAGGAGGAAGAGAAGGAGAGGGG + Intergenic
1061662483 9:132139329-132139351 GAGAAGGAAGAGAAGGGGAGGGG + Intergenic
1061731423 9:132617315-132617337 TGGAATAAGTAGAAGGAGATGGG - Intronic
1062304159 9:135893186-135893208 AAGAGAGAAGAGAAGGAGAGAGG + Intronic
1203343868 Un_KI270442v1:17695-17717 TGGAATGAAGTGAAGGGGAGTGG + Intergenic
1185644216 X:1605592-1605614 TAAAATAGAGATAGGGAGAGAGG - Intergenic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185787479 X:2903078-2903100 GAGAAGAAAGAGAGAGAGAGAGG - Intergenic
1185914855 X:4024508-4024530 TAGAATGATGTCAAGGAGAGAGG - Intergenic
1186062240 X:5721870-5721892 AAAAAGAAAGAGAAAGAGAGAGG + Intergenic
1186208345 X:7223978-7224000 TAGTTGAAAGAGAAGGAGAAAGG + Intronic
1186424839 X:9455700-9455722 AAGTAGAAAGAGAAGGAGAAAGG - Intergenic
1186538273 X:10372338-10372360 GAGATTACAGAGATGGAGAGGGG + Intergenic
1186543534 X:10425509-10425531 TGTAGTAAAGAGCAGGAGAGAGG + Intergenic
1186949474 X:14607480-14607502 GAACATAGAGAGAAGGAGAGAGG + Intronic
1187158858 X:16745829-16745851 AAGGACAAAGAGAATGAGAGAGG - Intronic
1187626261 X:21117408-21117430 AATAGTAAAGAGCAGGAGAGTGG + Intergenic
1187810460 X:23170890-23170912 TGGCATAAAGGGAAGGAGAAGGG - Intergenic
1188185824 X:27113485-27113507 TATAATAAAGATAAGGATATTGG + Intergenic
1188253028 X:27923124-27923146 AAAAAGAGAGAGAAGGAGAGTGG - Intergenic
1188529850 X:31127839-31127861 GGGAAGAAAGAGAAGGAGAGAGG - Intronic
1188669120 X:32861595-32861617 AAGAATGAAAAGAAGGAGAGTGG + Intronic
1189028560 X:37426430-37426452 TAGAGTAAAGAGAAGTAAAGAGG - Intronic
1189463543 X:41261383-41261405 AAGAACAAAGAGAAGGTTAGAGG + Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1190047538 X:47124738-47124760 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1190439582 X:50463656-50463678 AGAAACAAAGAGAAGGAGAGAGG - Intronic
1190515908 X:51223395-51223417 AAGATTGAAGAGAAGGAGTGGGG - Intergenic
1191779047 X:64847268-64847290 TGGAGTAATGAGGAGGAGAGGGG - Intergenic
1191784741 X:64905333-64905355 TATAAAATACAGAAGGAGAGAGG + Intergenic
1192277593 X:69649044-69649066 GAGAATGAAGAAAAGTAGAGAGG - Intronic
1192430556 X:71108699-71108721 TAGAAAAAAGAAAAGCAAAGTGG + Intronic
1192614287 X:72602287-72602309 GAGATTACAGAGAAAGAGAGAGG + Intronic
1193220697 X:78922720-78922742 TATAATAATGACAAGAAGAGGGG - Intergenic
1193490382 X:82142482-82142504 GAGAAGAAAAAGAAGGAGAGTGG - Intergenic
1194299913 X:92173352-92173374 TAGAATAAAGAAAATGAAAAAGG + Intronic
1194376644 X:93142839-93142861 CAGAAGAAAGAGAGGGTGAGGGG - Intergenic
1194607938 X:96005309-96005331 GAAAATAAAAACAAGGAGAGGGG + Intergenic
1194792988 X:98174099-98174121 GGGAAGAAAGAGAAGGGGAGGGG - Intergenic
1195152384 X:102085112-102085134 CAAAATAAAAAGAAAGAGAGAGG + Intergenic
1195323194 X:103737596-103737618 GAGAATAAAGAGGATAAGAGAGG + Intergenic
1195405724 X:104511087-104511109 TTGAATGATGAGAAGGAGACAGG - Intergenic
1195864840 X:109420238-109420260 AAGAAGAAAAAGAAAGAGAGAGG + Intronic
1196335934 X:114534462-114534484 TACAATAATGAAAAGGATAGTGG + Intergenic
1196931841 X:120689519-120689541 AACAAAAAAGAGGAGGAGAGAGG - Intergenic
1196960846 X:120999817-120999839 AAGAACAAAGAGAAGGTTAGAGG + Intergenic
1196961273 X:121004739-121004761 AAGAATAAAGAGAAGGTTAGAGG + Intergenic
1196979534 X:121196223-121196245 TAGAAGGAAGAAAAGAAGAGGGG - Intergenic
1197343406 X:125301706-125301728 TAGAATAAAGACATGGAGGTAGG - Intergenic
1197381706 X:125751298-125751320 TAGAATAAAGAAAAAAAGTGGGG + Intergenic
1197535222 X:127679030-127679052 TAGAGGAAGTAGAAGGAGAGTGG + Intergenic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1198080132 X:133231865-133231887 AAAAAAAAAGAGAAGGAGGGAGG + Intergenic
1198261291 X:134967067-134967089 TAAAATAAAAAGAAAGAAAGAGG - Intergenic
1198548256 X:137717268-137717290 TACACAAAAGAGAAGGAGAAAGG - Intergenic
1198683682 X:139205965-139205987 AAGAAAAGAGAGAAGGAGGGAGG + Intronic
1198692332 X:139297927-139297949 CAGAAAACAGATAAGGAGAGTGG - Intergenic
1198753376 X:139957750-139957772 GAAAATGAAGAGAAAGAGAGAGG - Intronic
1198755692 X:139979724-139979746 AAGAAAAAAGAAAAGGAGAAAGG + Intergenic
1198994366 X:142557249-142557271 TAGAATGGAGTCAAGGAGAGAGG - Intergenic
1199009561 X:142743124-142743146 TAGATTAAAGACAAGGAGGCTGG - Intergenic
1199039455 X:143094468-143094490 TAAAAGAAAGAGAAAGGGAGAGG + Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199767872 X:150953873-150953895 AAGAAAACAGAGAAGGAGGGGGG - Intergenic
1199862791 X:151816871-151816893 TAGGAGAAAGAGCAGGAGAAAGG - Intergenic
1199992579 X:152995865-152995887 CAGAAAAAAGAGAGAGAGAGAGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200480118 Y:3691471-3691493 TAGGACCAAGAGAGGGAGAGGGG - Intergenic
1200590333 Y:5065918-5065940 TTGAAAAAAGAAAAGAAGAGAGG - Intronic
1200708465 Y:6463069-6463091 TAGAATAAAGGGAGGAAGTGAGG - Intergenic
1200751126 Y:6945198-6945220 GAGAAGAAAGTGGAGGAGAGAGG - Intronic
1200763494 Y:7061607-7061629 TAGGGGAAGGAGAAGGAGAGGGG - Intronic
1200832303 Y:7699109-7699131 AAGAATAGAGGGAAGGAGAGGGG - Intergenic
1200960925 Y:8995078-8995100 AAGAATAGAGGGAAGGAGAGGGG + Intergenic
1201025647 Y:9701639-9701661 TAGAATAAAGGGAGGAAGTGAGG + Intergenic
1201097410 Y:10631945-10631967 TGGAATCAAAAGAAGTAGAGTGG - Intergenic
1201116271 Y:10837715-10837737 TAGAATGAAGAGAACTAGAATGG - Intergenic
1201117780 Y:10847781-10847803 TAGAATGGAGGGAAGGAGAATGG - Intergenic
1201123283 Y:10889457-10889479 TAGAATGAAAAGTAGGGGAGTGG - Intergenic
1201132173 Y:10960798-10960820 TAGAATGAAGTGAAGAGGAGTGG - Intergenic
1201137300 Y:10999673-10999695 TAGAATGAAGTGGAGTAGAGAGG - Intergenic
1201256429 Y:12112471-12112493 GAGAAGAGAGTGAAGGAGAGAGG - Intergenic
1201622992 Y:15980943-15980965 AAGAAGAGAGAGAAGGAGAGTGG + Intergenic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic
1201730710 Y:17199776-17199798 TAGAATAAAAAGGTGGAGAAAGG + Intergenic
1201741072 Y:17325299-17325321 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1202374423 Y:24220622-24220644 GAGAAGAAAGAGAAAGAGAGAGG + Intergenic
1202496357 Y:25449498-25449520 GAGAAGAAAGAGAAAGAGAGAGG - Intergenic