ID: 1070359135 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:75670637-75670659 |
| Sequence | ATGGTCAACGCACACCAAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1070359135_1070359140 | 17 | Left | 1070359135 | 10:75670637-75670659 | CCAGCTTGGTGTGCGTTGACCAT | No data | ||
| Right | 1070359140 | 10:75670677-75670699 | CTTCCCGTTTGTCTTAGCCTGGG | No data | ||||
| 1070359135_1070359139 | 16 | Left | 1070359135 | 10:75670637-75670659 | CCAGCTTGGTGTGCGTTGACCAT | No data | ||
| Right | 1070359139 | 10:75670676-75670698 | CCTTCCCGTTTGTCTTAGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1070359135 | Original CRISPR | ATGGTCAACGCACACCAAGC TGG (reversed) | Intronic | ||