ID: 1070359139

View in Genome Browser
Species Human (GRCh38)
Location 10:75670676-75670698
Sequence CCTTCCCGTTTGTCTTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070359137_1070359139 -3 Left 1070359137 10:75670656-75670678 CCATTAGGTTCTTTCTCTCTCCT No data
Right 1070359139 10:75670676-75670698 CCTTCCCGTTTGTCTTAGCCTGG No data
1070359135_1070359139 16 Left 1070359135 10:75670637-75670659 CCAGCTTGGTGTGCGTTGACCAT No data
Right 1070359139 10:75670676-75670698 CCTTCCCGTTTGTCTTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070359139 Original CRISPR CCTTCCCGTTTGTCTTAGCC TGG Intronic