ID: 1070359621

View in Genome Browser
Species Human (GRCh38)
Location 10:75674749-75674771
Sequence CTGCAGAGTAGCAGAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070359620_1070359621 -5 Left 1070359620 10:75674731-75674753 CCTTTGCTTTTATTAATTCTGCA 0: 1
1: 0
2: 3
3: 40
4: 494
Right 1070359621 10:75674749-75674771 CTGCAGAGTAGCAGAATTGTTGG No data
1070359618_1070359621 8 Left 1070359618 10:75674718-75674740 CCTTGACTCCTTGCCTTTGCTTT 0: 1
1: 1
2: 1
3: 48
4: 582
Right 1070359621 10:75674749-75674771 CTGCAGAGTAGCAGAATTGTTGG No data
1070359619_1070359621 0 Left 1070359619 10:75674726-75674748 CCTTGCCTTTGCTTTTATTAATT 0: 1
1: 0
2: 4
3: 129
4: 1666
Right 1070359621 10:75674749-75674771 CTGCAGAGTAGCAGAATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070359621 Original CRISPR CTGCAGAGTAGCAGAATTGT TGG Intronic
No off target data available for this crispr