ID: 1070361741

View in Genome Browser
Species Human (GRCh38)
Location 10:75697107-75697129
Sequence TGTTCAGCAGAGTCACCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070361740_1070361741 -4 Left 1070361740 10:75697088-75697110 CCATGAGGCAGTGAGGAGATGTT 0: 1
1: 0
2: 1
3: 21
4: 176
Right 1070361741 10:75697107-75697129 TGTTCAGCAGAGTCACCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070361741 Original CRISPR TGTTCAGCAGAGTCACCTCA AGG Intronic
No off target data available for this crispr