ID: 1070364943

View in Genome Browser
Species Human (GRCh38)
Location 10:75727604-75727626
Sequence CATTGTCACGTTAAAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070364943 Original CRISPR CATTGTCACGTTAAAGAACA TGG (reversed) Intronic
900710769 1:4112164-4112186 CATTCTCACAGTCAAGAACAAGG + Intergenic
910536380 1:88302621-88302643 CAAGGTCACGTTAAAAATCAGGG + Intergenic
910679638 1:89849134-89849156 CATAGTCTAGTTCAAGAACAAGG - Intronic
911903414 1:103533305-103533327 TATTGTGAGGTTAAGGAACAAGG + Intronic
918204241 1:182295093-182295115 TCTTGGCACTTTAAAGAACAGGG - Intergenic
918486883 1:185038612-185038634 CATTATCACGTAACATAACATGG + Intergenic
918773587 1:188598021-188598043 TTTTGTCACAATAAAGAACATGG - Intergenic
922347013 1:224704692-224704714 CATTGTCACACCAAAGAACATGG + Intronic
1066339642 10:34518365-34518387 CATTCTCCAGTTAATGAACAAGG + Intronic
1068044664 10:51871205-51871227 CATTGTCTCCTTTCAGAACATGG + Intronic
1070364943 10:75727604-75727626 CATTGTCACGTTAAAGAACATGG - Intronic
1070900594 10:80025445-80025467 CATTATCACATTGAAGATCATGG + Intergenic
1072200095 10:93150430-93150452 CAATGTCAGGTCAAAAAACAGGG - Intergenic
1080096288 11:28411660-28411682 CATTGTCAAGTCCAAGATCAAGG - Intergenic
1080167992 11:29263216-29263238 AACTGTCTTGTTAAAGAACAAGG - Intergenic
1081723000 11:45303835-45303857 CCTTGTCTCGTAAAACAACAGGG - Intergenic
1084618255 11:70251012-70251034 CATTGTCACCTAAATGAACAAGG + Intergenic
1085837355 11:79971287-79971309 CATTGGCAGGTTAGAGATCATGG - Intergenic
1089128840 11:116195963-116195985 CATTGTCAGGTAAATGGACAGGG - Intergenic
1090043946 11:123314839-123314861 CATTGTGACATCACAGAACAAGG + Intergenic
1090421906 11:126581044-126581066 CAATGCCAGTTTAAAGAACATGG + Intronic
1091777124 12:3191807-3191829 CATTGTCACCCTAACAAACATGG + Intronic
1092531131 12:9346520-9346542 CATTGTTAAGCTAAAGAATATGG - Intergenic
1098165820 12:67696441-67696463 GATTGTCTTGTTAAAGAACAGGG - Intergenic
1099278048 12:80603400-80603422 GATTGTTACGTTAAAGAATTTGG - Intronic
1101514544 12:105422133-105422155 CATTGTAGCATTAAAGAACAAGG - Intergenic
1104171359 12:126284717-126284739 CCATGTCACTTTAAAGGACATGG - Intergenic
1106413606 13:29527849-29527871 CATTACCACGTAGAAGAACAGGG - Intronic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1110419403 13:75288401-75288423 CAGTGTCAAGCCAAAGAACATGG - Intronic
1114704054 14:24707748-24707770 CATTGTCACCTTAAATAAATTGG + Intergenic
1117235635 14:53771639-53771661 CTTTGTCTCTTTAAAAAACAAGG - Intergenic
1122181844 14:99960888-99960910 CATTGTTAAGTGAAAGAAGACGG - Intergenic
1202901786 14_GL000194v1_random:48161-48183 CATTGACATGTCAAAGATCATGG + Intergenic
1123663832 15:22590582-22590604 CATTATCAAGTTAAAGAAGCAGG - Intergenic
1123850927 15:24355805-24355827 CATTGTCATGCTAAGGTACAAGG - Intergenic
1124123726 15:26915542-26915564 AATTGTCACAGTAAAGAAAATGG - Intronic
1124317664 15:28685029-28685051 CATTATCAAGTTAAAGAAGCAGG - Intergenic
1124565782 15:30812479-30812501 CATTATCAGGTTAAAGAAGCAGG + Intergenic
1133553182 16:6878896-6878918 CATCTTCAAGTTAAAGAAAAGGG + Intronic
1139037885 16:62969698-62969720 GATTGTGAAGTTAAAGAAAATGG + Intergenic
1140678860 16:77364187-77364209 CATTCTCACAGTAATGAACATGG - Exonic
1140791485 16:78395874-78395896 CATAGTCATGTCAAAGAAAATGG - Intronic
1140874545 16:79138513-79138535 CATAGACAGGTTAGAGAACATGG + Intronic
1141009859 16:80387304-80387326 CAGTGTCACCTTGAAGAATATGG - Intergenic
1144023476 17:11257358-11257380 CATTATCAAGTAAAAGCACAGGG + Intronic
1144325941 17:14179990-14180012 CATTATTAACTTAAAGAACAGGG + Intronic
1144474815 17:15576878-15576900 CATTATTAACTTAAAGAACAGGG + Intronic
1144532091 17:16049391-16049413 CATCGTCAAGTTAAAGATAAAGG + Intronic
1146972179 17:37082235-37082257 CATAGTCACTTACAAGAACAGGG - Intergenic
1156338296 18:36188316-36188338 CAATTTCACCTTTAAGAACAGGG + Intronic
1156677798 18:39551881-39551903 CATTGTGACTTCACAGAACATGG - Intergenic
1160095791 18:75871549-75871571 CATTGTAAGGTGAAAGAACAAGG + Intergenic
1164363722 19:27549097-27549119 CATTATCAGGTTAGAAAACAAGG - Intergenic
926653814 2:15376534-15376556 CTTTGTCAAGTTCAATAACATGG + Intronic
931593308 2:63910327-63910349 CATTGACCCGTTGAAGAATATGG - Intronic
931979755 2:67681978-67682000 CATTGTCATGTGAAGGGACATGG - Intergenic
935846772 2:107174441-107174463 CATTGGCACGATATAGCACACGG - Intergenic
939007230 2:136803713-136803735 CATCTTCACGCTGAAGAACATGG + Intronic
939120654 2:138112241-138112263 AATTATCATGTTAAAGAAGAGGG - Intergenic
939241630 2:139568472-139568494 TATTGTCACTTTCAACAACACGG + Intergenic
939551581 2:143622414-143622436 TACTGTCACTTTAAAGAACGGGG - Intronic
942956993 2:181784915-181784937 AATTGTCACGTCAAAGAAAATGG - Intergenic
943529672 2:189063384-189063406 CATTTTCATGTTAAAGAATCAGG + Intronic
943828809 2:192431438-192431460 CATTGTTACATTTAAGAAGATGG + Intergenic
1169962350 20:11175411-11175433 CATTGGCATGTTATAGAAGAAGG + Intergenic
1172381174 20:34493611-34493633 AATTGTCATGTTATGGAACATGG + Intronic
1176621154 21:9062928-9062950 CATTGACATGTCAAAGATCATGG + Intergenic
1178248183 21:30974356-30974378 CATTGTAACTTTAAATAATAAGG - Intergenic
1178603886 21:34018422-34018444 CATTGTCATGTGAAAAATCAAGG + Intergenic
1179142008 21:38733959-38733981 CATCGTCACTTTACAGAAAATGG + Intergenic
1179549223 21:42133009-42133031 ATTTCTCACGTTCAAGAACAAGG + Intronic
1182400668 22:30074386-30074408 CCCTGGCACGTTTAAGAACATGG + Intergenic
956249269 3:67218748-67218770 TATTTTAACATTAAAGAACAAGG - Intergenic
961835749 3:129657523-129657545 CATTGTAAAGTTTAAGAACTTGG - Intronic
962073752 3:132058571-132058593 CATTGTCCCATGAAAGGACAAGG - Intronic
963688317 3:148466277-148466299 CATTGTTAGGTTTAAGAGCAAGG + Intergenic
966168532 3:177050175-177050197 CATTCTCACGTATCAGAACAAGG + Intronic
966616691 3:181921039-181921061 CATTATCAGGTAAAAGCACATGG + Intergenic
968053326 3:195671701-195671723 TGTTATCACATTAAAGAACAGGG - Intergenic
968102487 3:195976660-195976682 TGTTATCACATTAAAGAACAGGG + Intergenic
973049468 4:45577036-45577058 CATTGTAACATTAAACAACATGG - Intergenic
973946067 4:55957049-55957071 CATTGTTTAGTTAAAGATCAGGG + Intronic
978786834 4:112619486-112619508 CATTGTGACTTACAAGAACAGGG - Exonic
982542163 4:156687503-156687525 CAATGTAACATTATAGAACAAGG + Intergenic
983761338 4:171410120-171410142 CATAGCCATTTTAAAGAACAAGG + Intergenic
984807151 4:183762194-183762216 TATTGTCACCTTAATTAACATGG - Intergenic
985013857 4:185612897-185612919 CATTGTCAGGGTGAAGACCAGGG - Intronic
986085766 5:4444141-4444163 CATTTTCACTCTAAAGATCAAGG - Intergenic
986494194 5:8325982-8326004 AATTGTCACTTAAAAAAACATGG + Intergenic
988415000 5:30935348-30935370 CATTATCAAGTCAAAAAACATGG + Intergenic
990120803 5:52449200-52449222 CATTGGTATGCTAAAGAACAGGG + Intergenic
991077979 5:62563235-62563257 TATTGAAATGTTAAAGAACATGG + Intronic
991246817 5:64517331-64517353 CATTGCCACCTTAAATAAAAAGG + Intronic
994969082 5:106713109-106713131 CATTTTCACCTTAAAATACATGG + Intergenic
995784422 5:115814055-115814077 GACTGTCATGTTAAAGAAAAGGG + Intronic
1000217280 5:159172917-159172939 CATTGTCACTTTAAAAAGTAGGG - Intronic
1000653650 5:163849425-163849447 CACTGTCACCTAAAACAACAGGG - Intergenic
1001853859 5:174993826-174993848 CATTGTTAAGTTAAAAAAAAAGG + Intergenic
1004098344 6:12582234-12582256 CATTGTCAATGTCAAGAACACGG + Intergenic
1011548991 6:88511882-88511904 CATTACCAGCTTAAAGAACAGGG + Intergenic
1012708246 6:102563044-102563066 CATTGTCATGATAAATAACAAGG - Intergenic
1014536840 6:122624131-122624153 TATTGTCATGTTTGAGAACATGG - Intronic
1016810481 6:148256184-148256206 CACTGTCAAGTTACAGACCATGG - Intergenic
1018166639 6:161104111-161104133 CATTGACATATTAAAGACCAAGG + Intronic
1022602803 7:31777628-31777650 CATTTTCATCTTAAACAACAGGG + Intronic
1028736917 7:94224267-94224289 CATTTTAACGTTTAAGAATAAGG + Intergenic
1031237202 7:119191034-119191056 CATCTGCAAGTTAAAGAACAAGG - Intergenic
1031256389 7:119455569-119455591 CATGTTCACGTTGAAAAACAAGG + Intergenic
1031814034 7:126409524-126409546 CACTCTCATGTTAAAGAAAATGG + Intergenic
1031852086 7:126877955-126877977 CATATTCACGTTAAAGAAACTGG + Intronic
1036908461 8:12729967-12729989 CACAGGCACGCTAAAGAACATGG + Intronic
1036975071 8:13401683-13401705 TTTTGTCACATTGAAGAACAGGG - Intronic
1039094552 8:33869447-33869469 CATTGTGTGGTTAAAGAAAATGG - Intergenic
1042065799 8:64874549-64874571 CATTGTCAAGTCAAATAATATGG + Intergenic
1042201194 8:66280696-66280718 CATTGGGACGTTCAAGATCAAGG + Intergenic
1043045615 8:75319971-75319993 CACTGTCACGTGTAACAACATGG - Intergenic
1044118786 8:88367833-88367855 CATTGTCACTTTAATGCACTGGG - Intergenic
1045373903 8:101552307-101552329 AAGTGTCACCATAAAGAACAGGG - Intronic
1045795677 8:106040870-106040892 CATTATCAAGATAATGAACATGG + Intergenic
1047586748 8:126281501-126281523 CAGTGTCACGTCAAAGCACATGG + Intergenic
1048775643 8:137943247-137943269 CATTGTCATTTTATAGAAAAGGG + Intergenic
1057604699 9:96490745-96490767 GATTGGCAGGTTAAATAACATGG - Exonic
1058372546 9:104286416-104286438 CAGTGTGATGGTAAAGAACAGGG - Intergenic
1062685853 9:137813027-137813049 AGATGTCACCTTAAAGAACAAGG + Exonic
1186628392 X:11320269-11320291 CAGGGTCAAGTTAAAGAATATGG + Intronic
1186659356 X:11653127-11653149 CATTTACCAGTTAAAGAACAGGG + Intronic
1197896770 X:131324426-131324448 CATTTACACCTTAAGGAACAAGG - Intronic
1199370656 X:147043560-147043582 CATTGCCACTTTAAAGAATTAGG - Intergenic
1200316553 X:155138531-155138553 GATTTTCACATTCAAGAACATGG - Intronic
1200749927 Y:6935520-6935542 AATTGTCACAATAAAAAACAAGG - Intronic