ID: 1070366197

View in Genome Browser
Species Human (GRCh38)
Location 10:75739389-75739411
Sequence CAGCATATGAATTTTGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070366197_1070366202 27 Left 1070366197 10:75739389-75739411 CCATGTACAAAATTCATATGCTG 0: 1
1: 0
2: 3
3: 21
4: 311
Right 1070366202 10:75739439-75739461 TTCTGTTCTGTGAGACTGACGGG No data
1070366197_1070366201 26 Left 1070366197 10:75739389-75739411 CCATGTACAAAATTCATATGCTG 0: 1
1: 0
2: 3
3: 21
4: 311
Right 1070366201 10:75739438-75739460 TTTCTGTTCTGTGAGACTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070366197 Original CRISPR CAGCATATGAATTTTGTACA TGG (reversed) Intronic
902079277 1:13810116-13810138 CAGCATATGAATGGGGTGCAGGG + Intronic
902709510 1:18228957-18228979 CAAAGTCTGAATTTTGTACAAGG + Intronic
904790546 1:33017114-33017136 CAGTATATCAATTCTTTACATGG - Intronic
906268644 1:44456324-44456346 GATTATATGAATTTTGTGCATGG + Intronic
907428891 1:54399186-54399208 CAGCCTATTAATTTTTTCCATGG - Intronic
907935056 1:59034496-59034518 CAACATATGAATTTTAACCAGGG + Intergenic
908005638 1:59724976-59724998 CAGCTTATCAATTTTTTTCATGG + Intronic
908483512 1:64567670-64567692 CAGCATATGTTTTTAGAACATGG - Intronic
908557282 1:65268551-65268573 TAGATTAAGAATTTTGTACAGGG + Intronic
908960308 1:69689682-69689704 CCGTATATGATTTTAGTACAAGG + Intronic
909734439 1:78938967-78938989 TAGCATATGAAATATGTAAAAGG + Intronic
910412487 1:86962360-86962382 TAAAATATGAAGTTTGTACACGG + Intronic
910514642 1:88046571-88046593 CAACATATGAATTTGGTGCGGGG - Intergenic
910813405 1:91261951-91261973 CAGTATGTTAATTTTGTAAAGGG - Intronic
910882609 1:91935877-91935899 CAGTATATGAATTGGGGACAGGG + Intergenic
911172852 1:94787736-94787758 CAGCCTATTAATTTTTTTCATGG - Intergenic
913428311 1:118759901-118759923 AAGCATATCAATTTTATAAAAGG + Intergenic
913707235 1:121437751-121437773 CAGCACATGAATTATTTTCAAGG + Intergenic
916309594 1:163381456-163381478 CAGAATATGAATATATTACAGGG + Intergenic
921408966 1:214814270-214814292 CAACATATGAATTTTTTTGAGGG - Intergenic
921968628 1:221120287-221120309 CAACATATGAATTTTGGAGAGGG + Intergenic
923921994 1:238577125-238577147 CAGCATATAGATCCTGTACATGG - Intergenic
924856130 1:247876671-247876693 GAGCATAATAATTTTGTAAATGG + Exonic
1063718320 10:8552728-8552750 CAACATATGAATTTTGGGGAGGG + Intergenic
1063872147 10:10429373-10429395 CAGCATATCAATGATGTACGTGG + Intergenic
1065248939 10:23789837-23789859 CACCAAATGAAATTTCTACATGG - Intronic
1065308690 10:24393555-24393577 CAACATATGAATTTGGGAGAGGG - Intronic
1067822287 10:49540659-49540681 CAGCATATGAATTTTGGGGAGGG - Intergenic
1068473839 10:57500175-57500197 CAGGTTAGGAATTCTGTACAGGG - Intergenic
1068859199 10:61829786-61829808 CAACATATGAATTTTGGGGAGGG - Intergenic
1069787847 10:71000671-71000693 CAACATATGAATTTTGTGTGCGG + Intergenic
1070366197 10:75739389-75739411 CAGCATATGAATTTTGTACATGG - Intronic
1070700269 10:78596884-78596906 CAACATATGAATTTTGTGGGGGG - Intergenic
1071258015 10:83891373-83891395 CACCATATGATTTATGTACAAGG + Intergenic
1072192907 10:93090623-93090645 CAACATATGAATTTTGTGAGAGG + Intergenic
1074544362 10:114391098-114391120 CTGCCTATTAATTTTGTCCAGGG + Intronic
1075207923 10:120462746-120462768 CAGAATCTGCATTTTGAACAGGG + Intronic
1075245843 10:120821654-120821676 CAGCATATGAATTTTGAGGTGGG - Intergenic
1075378904 10:122002286-122002308 CAACATATGAATTTGGGGCAGGG + Intronic
1076398636 10:130161695-130161717 CAGCATACTAATGTTGTACTAGG - Intronic
1076503910 10:130959176-130959198 CTGCATCTGAATTCTGTCCATGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077277211 11:1718351-1718373 CAGCATATTAATGATGTAAAAGG + Intergenic
1077772737 11:5238002-5238024 AAGAATGTGAATTTTGTAGAAGG - Intergenic
1078311551 11:10248524-10248546 CAGCATTTTAATTATGTACTAGG - Intronic
1078319230 11:10318803-10318825 TAGCATATGAATTTGGTGTATGG - Intronic
1079329001 11:19518792-19518814 CAGCATAGGAATTTTGAGTAGGG - Intronic
1079551957 11:21710804-21710826 CAGCATATGAATTTTGGTGAGGG + Intergenic
1079785889 11:24672678-24672700 CAGTCTATGATTTTTGCACAAGG - Intronic
1080053470 11:27881148-27881170 CAACATATGAATTTTGTTGGGGG - Intergenic
1082100062 11:48165514-48165536 CAGAATATTAATTTTGTATCAGG + Intronic
1082642157 11:55675792-55675814 CTGCATCTGAAATTTGCACATGG + Intergenic
1082707035 11:56505170-56505192 CAGCATATGAATTTTGGAGAGGG - Intergenic
1083570164 11:63756235-63756257 TGGCATCTGCATTTTGTACAAGG - Intronic
1083935802 11:65869560-65869582 CTGCATTTGAATTTTGCACTAGG - Intronic
1084464190 11:69312795-69312817 CAGCAGATGATTTTTCTAGAAGG + Intronic
1085663303 11:78389922-78389944 TTGCATAATAATTTTGTACATGG + Intronic
1087154010 11:94883515-94883537 CAGCATTTGAAAAATGTACAAGG + Intergenic
1089370882 11:117956151-117956173 CAACATATGAATTTGGTAGGGGG - Intergenic
1089534611 11:119153304-119153326 CAGCATATGCATTTAGAGCACGG - Intronic
1090651916 11:128814390-128814412 CAGCATATGAATTTGGGAGAAGG + Intergenic
1091169025 11:133504379-133504401 CAGCAAATGTATTTTGTGAAGGG - Intronic
1091790106 12:3267276-3267298 CAGAATATAAATGCTGTACAAGG - Intronic
1091997032 12:5001789-5001811 CAGCATTTGCATTCTGTGCATGG + Intergenic
1093269211 12:17038156-17038178 CAGCATTTGAAATCTGTAGAAGG - Intergenic
1093401407 12:18751456-18751478 CATCATTTGAAGTTTCTACATGG - Intergenic
1094412730 12:30184381-30184403 CAGCATACGAATTTTGGAGAGGG + Intergenic
1094620165 12:32073216-32073238 CAGCACATGAATTTTGGGCAAGG + Intergenic
1095992367 12:48044724-48044746 AAGCAGATGGATTTTGTATAGGG + Exonic
1097958864 12:65513187-65513209 CAGCAGATGAATTTTTTGTAAGG - Intergenic
1098789326 12:74801400-74801422 AATAATTTGAATTTTGTACAAGG - Intergenic
1099306888 12:80968579-80968601 CAGCAAATGTTTTTTGTAAAGGG + Intronic
1102718653 12:114997081-114997103 CAATATATGAATTTGGTGCAGGG + Intergenic
1103004896 12:117413387-117413409 GAGCTTATGAATTTTGCTCAAGG + Intronic
1103113429 12:118303541-118303563 CATAATATGAAGTTTGTAAATGG - Intronic
1103162031 12:118737308-118737330 CAACATATGAATTTGGGGCAGGG - Intergenic
1104344288 12:127982011-127982033 CAGCATGTTAATTTTTTACTAGG - Intergenic
1107065414 13:36209666-36209688 CAACATATGAATTCGGTAGAGGG + Intronic
1107365794 13:39673612-39673634 CATCATATGAATTAGGTAAAAGG + Intronic
1109082912 13:57929996-57930018 CAACATATGAACTTTGCTCAAGG + Intergenic
1110121270 13:71884744-71884766 CAGCATAAGAATTTGGGGCAGGG - Intergenic
1113223884 13:108138106-108138128 CAGCAGCTGAATTTTTTAAATGG - Intergenic
1113260960 13:108562347-108562369 CAACATATGAATTTTTTAGGGGG + Intergenic
1114134327 14:19829813-19829835 AGGAATATAAATTTTGTACATGG + Intergenic
1114319295 14:21533804-21533826 CAGCATTTGCATGTTGTATATGG + Intronic
1116603116 14:46953531-46953553 AAGCATATGCATTTATTACATGG - Intronic
1117080356 14:52145383-52145405 CAGCAGTTGATTTTTGTATATGG + Intergenic
1117397467 14:55325088-55325110 CAACATATGAATTGTGTCCTGGG + Intronic
1117595335 14:57321275-57321297 CAGCTTCTGAATTTTCTAAAGGG - Intergenic
1117985325 14:61381066-61381088 CAGTTTCTGAACTTTGTACAGGG - Intronic
1120049284 14:79846329-79846351 TAGCACATGAATTTTTTACATGG - Intronic
1120322410 14:82981359-82981381 CAGCAAGTGAGTTTTCTACAAGG - Intergenic
1120694066 14:87624460-87624482 CAGCGTGTGAACTTTGTTCATGG - Intergenic
1120730998 14:88001684-88001706 CAGCATATGAATTTTGGGAAAGG + Intergenic
1121894457 14:97633426-97633448 CAGCATATGAAATTTCTCCAAGG + Intergenic
1123176160 14:106421259-106421281 CAGCATATGAATTTCAAAAAGGG + Intergenic
1202947524 14_KI270726v1_random:42304-42326 CAGCATATGAATTTCAAAAAGGG - Intergenic
1123577386 15:21685405-21685427 AGGAATATAAATTTTGTACATGG + Intergenic
1123584101 15:21741920-21741942 CAGCATATGAATTTAAGAGAAGG + Intergenic
1123614008 15:22127875-22127897 AGGAATATAAATTTTGTACATGG + Intergenic
1123620751 15:22184523-22184545 CAGCATATGAATTTAAGAGAAGG + Intergenic
1123768033 15:23501074-23501096 CAACATATGAATTTTGGAGGAGG - Intergenic
1124023061 15:25941317-25941339 CAACATATGAATTTTGCAGGAGG + Intergenic
1124570256 15:30856493-30856515 CAACATATGAATTTTGGAGGAGG + Intergenic
1125033584 15:35097498-35097520 CAGCATGTGCATTTGGGACAGGG - Intergenic
1125062362 15:35439631-35439653 CAGGTTAGGAACTTTGTACAGGG - Intronic
1125276726 15:38000929-38000951 CAGCATATGGATTATTTTCAAGG - Intergenic
1125782886 15:42286450-42286472 CAGAATTTGAACTTTGTACTTGG + Intronic
1126301426 15:47201328-47201350 AGGCCTATGAATTTTGTAAATGG - Intronic
1126824385 15:52534613-52534635 CAGCATATGAATTTTGGATGGGG - Intergenic
1127197361 15:56603487-56603509 CAGCATATAGATTTGGTCCATGG + Intergenic
1128209963 15:65890933-65890955 CAAAAAATGAATTTTGTAAAAGG + Exonic
1128668583 15:69557284-69557306 CAGCATTTCCATTTTGCACAGGG - Intergenic
1131097393 15:89665228-89665250 CAGAATCTGAATTTTGGAAACGG + Exonic
1131533177 15:93212113-93212135 CAACATATGAATTTTGGGGAGGG - Intergenic
1131672283 15:94632405-94632427 CAGAAGGTGAATCTTGTACAAGG - Intergenic
1202986255 15_KI270727v1_random:419650-419672 AGGAATATAAATTTTGTACATGG + Intergenic
1133780276 16:8933486-8933508 CATCTTTTGAATTTTGTAAAGGG - Intronic
1134195284 16:12154943-12154965 CAGCATATGAATTTGGCAGTGGG + Intronic
1135395215 16:22126213-22126235 CTGGATATGAATAATGTACATGG - Exonic
1135664489 16:24324610-24324632 TAGGATATGCATTTTGTAAATGG - Intronic
1138310382 16:56018637-56018659 CAGCATATGAATTTGGGGGAGGG - Intergenic
1139130191 16:64133683-64133705 CAACACATGAATTTTGTAGTGGG + Intergenic
1142219175 16:88844805-88844827 CAGCAAATGCATTATGTAAAGGG + Intronic
1148245393 17:46026772-46026794 CAGCAGATGGAGTTTGTGCAAGG - Exonic
1150629887 17:66872169-66872191 CAGTCTGTGAATTTTGTATACGG + Intronic
1155117205 18:22781267-22781289 AAGCATACATATTTTGTACATGG - Intergenic
1156113555 18:33758370-33758392 CAGCTTATGAATTTGGTAGGGGG - Intergenic
1156599069 18:38582906-38582928 CAGCATAGGACTTTTTTAGATGG - Intergenic
1156770958 18:40724408-40724430 AAGTATATAAATTTTGCACATGG + Intergenic
1157231722 18:45923294-45923316 CAGCATATGGCTTCTGTGCAAGG + Exonic
1159125177 18:64215817-64215839 CGACATATGAATTTTGTAGGAGG - Intergenic
1159698023 18:71586013-71586035 TAGCAAATGAATTTTTTAAAAGG - Intergenic
1163192645 19:15688939-15688961 AAGCCTTTGATTTTTGTACAAGG - Intronic
1163331019 19:16637849-16637871 CAGCATATGAATTTAGTCATGGG - Intronic
1163865714 19:19771605-19771627 CAGCATATGCATTCTCTTCAAGG + Intergenic
1165267444 19:34672954-34672976 CAGCATATGAATTCTGTGGCGGG + Intronic
1165563793 19:36705622-36705644 CAGAATATGCATTCTTTACAAGG - Intronic
1166522417 19:43489582-43489604 CACCATGTGAATTTTGAACGAGG + Intronic
1166764191 19:45243200-45243222 CACTATATGAATTGTGTAAAGGG + Intronic
925632714 2:5911991-5912013 AAGCATCTGAGTGTTGTACAAGG + Intergenic
926342319 2:11913906-11913928 CAGCATATGAATTTGGCATGGGG + Intergenic
926622930 2:15063533-15063555 CAACATATGAATTTTGGGAAAGG - Intergenic
928863213 2:35885588-35885610 CAGAATATGCATTTTATACTTGG - Intergenic
929303808 2:40336423-40336445 CAGAATATCCATTTTATACATGG + Intronic
929396794 2:41532797-41532819 CAAGATATGAATTTTGGAAAGGG + Intergenic
929469057 2:42172731-42172753 CAGTATATACATTTTGCACATGG - Intronic
932088775 2:68786310-68786332 CACCAGATAAATTTTGTCCAAGG + Intronic
934049282 2:88196995-88197017 GAACATATGAATTTTGGAGAGGG - Intergenic
934102343 2:88665097-88665119 CAGGATATGAAGTTTGGAGAGGG + Intergenic
935126604 2:100229835-100229857 CAGAATATCAATTTTTTTCAAGG + Intergenic
936416336 2:112317134-112317156 CAACAGCTGAATTTTCTACATGG - Intronic
936867960 2:117098356-117098378 CAGCATGGGAATTTTATACTTGG + Intergenic
937387951 2:121454156-121454178 CAGCATATTAATTTTGGAGGGGG - Intronic
939117402 2:138076166-138076188 CAACATATGAATTTGGTGGAAGG + Intergenic
939224188 2:139344509-139344531 CAGCAAATTAATTTTGAAAATGG - Intergenic
940326974 2:152435683-152435705 TAGCATTTTAATTTTGTTCAAGG + Intronic
941277888 2:163513693-163513715 CAACATATGAATTTGGGGCAGGG + Intergenic
941647841 2:168060272-168060294 CAGCATATGAATTTTTTTCAGGG - Intronic
942493383 2:176512358-176512380 CAACATATGAATTTGGGAAAGGG - Intergenic
943198141 2:184782163-184782185 CAACATATGAATTTTGTTGGGGG + Intronic
943930797 2:193850284-193850306 CAGCATATGAATTTTTTGGGAGG + Intergenic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
945570175 2:211457601-211457623 CTGCACTTGAATTTTGCACAGGG + Intronic
945743437 2:213691096-213691118 CAACATCTGAATTTTGGAGAGGG + Intronic
945798206 2:214390861-214390883 CTGCCTATCAATTTTGTACATGG - Intronic
946533740 2:220604628-220604650 CAACATATGAATTTTGGAAGGGG + Intergenic
946625721 2:221610520-221610542 CAGCATATGAATTTAGGGCAAGG + Intergenic
947258192 2:228189682-228189704 CAGCATATGAATTGTGTGTAGGG + Intergenic
947280818 2:228452532-228452554 CACCATATTAATTTTTTAAAAGG - Intergenic
947985192 2:234441595-234441617 CAACATATGAATTTTGTGGGGGG + Intergenic
948261260 2:236606072-236606094 CAGCATATGAATTTTGGGGGTGG + Intergenic
1169215539 20:3792211-3792233 CAGCATATGAACATTGTTCTAGG - Intronic
1169701984 20:8456962-8456984 CAACATATGAATTTTGGATTGGG + Intronic
1170534238 20:17324449-17324471 CAGAAAATGAATTTATTACAAGG + Intronic
1171005294 20:21459016-21459038 CTGCATTTGAATTTTCTACCTGG - Intergenic
1171139167 20:22725948-22725970 CAACATATGAGTTTTGGAGAAGG + Intergenic
1172256004 20:33518281-33518303 CAGCATGGGAATTTGGTGCATGG - Intronic
1172609466 20:36239256-36239278 CAGCATCTAAAGTTTGTTCAGGG - Intronic
1172993496 20:39052726-39052748 CAGCACATGCCATTTGTACAGGG + Intergenic
1173060962 20:39660749-39660771 CAGCATATAAATTTTGGAAGGGG + Intergenic
1173435188 20:43026040-43026062 TAGCATATGAATTTTGGAGGGGG - Intronic
1174164216 20:48573329-48573351 CAGCAGGTGAATTATGCACAAGG + Intergenic
1175370065 20:58482310-58482332 AAGCACATTAATTTTCTACACGG - Intronic
1175657918 20:60787954-60787976 CAGCAGATGAATTGTGAATAAGG - Intergenic
1176523398 21:7844808-7844830 CAACATATGAAATTTGTGGAGGG + Intergenic
1177922063 21:27164491-27164513 CACCAAATGATTTTTATACATGG + Intergenic
1178657418 21:34474820-34474842 CAACATATGAAATTTGTGGAGGG + Intergenic
1178676719 21:34637395-34637417 CAGCATATGAATTTGAGAAAGGG + Intergenic
1180662579 22:17481585-17481607 CAGCAAATGTTTTTTGTAAAGGG + Intronic
1181614797 22:24046396-24046418 CAGAATATGATAGTTGTACAGGG + Intronic
949213991 3:1542778-1542800 CATCATATGGATATTTTACAGGG - Intergenic
949748093 3:7318580-7318602 CAGCATCTGATTTTTGTTAAAGG - Intronic
951372603 3:21869079-21869101 CAGCATACAACTTTTGTAGAAGG - Intronic
951869401 3:27343939-27343961 CAGCATAAGAATGTTGTCCGTGG + Intronic
952332885 3:32381073-32381095 CAGCATATGAATTTGGTGGGGGG + Intergenic
952682434 3:36109982-36110004 CATCATCTGAGTTTTGTTCATGG - Intergenic
955473144 3:59307826-59307848 CAGCATTTAAATTTTCTAAAAGG + Intergenic
955788202 3:62561873-62561895 ATGTATATGAATTTTGGACAAGG - Intronic
955891892 3:63659075-63659097 AAGCATACGAATTTTCTTCATGG + Intronic
956425065 3:69125516-69125538 CAACAAATCAATTTTGTTCAGGG + Intergenic
956470512 3:69561805-69561827 CAGCATATGAATTTCAGAAATGG - Intergenic
956499155 3:69863269-69863291 CATCTCATGAATTTTGTATATGG + Intronic
957106510 3:75896209-75896231 CAGCATTTTAATTTTTTAGATGG + Intergenic
957335271 3:78819715-78819737 AAGAATATGAATTTGGTAGAAGG - Intronic
957464106 3:80563565-80563587 CATCATCTGAATAGTGTACATGG - Intergenic
958714306 3:97761378-97761400 CATAATAAGATTTTTGTACAAGG + Intergenic
958918877 3:100080493-100080515 CAGGATCTGAATTTAGTACCTGG + Intronic
959051464 3:101528633-101528655 CAACATATGAATTTTGTTGGTGG - Intergenic
960896146 3:122507471-122507493 CAGCATATAAAATTTGAATATGG + Intronic
961840210 3:129704353-129704375 GAGCATATGAATACTGTATATGG - Intronic
964192405 3:154018544-154018566 CAGCAATTGAAACTTGTACATGG + Intergenic
964507689 3:157417542-157417564 CAGCATTGGAATTTTGGCCATGG - Intronic
964699503 3:159549361-159549383 CAGCATATAAATTTTGTGGGGGG - Intronic
965794831 3:172428793-172428815 CAACATATGAATTTAGCAGAGGG + Intergenic
965826704 3:172738058-172738080 CAGAATATGTATTTTTTTCAGGG - Intergenic
966622410 3:181980268-181980290 CAGCATATGAATTTGGGAGCAGG - Intergenic
966934988 3:184700693-184700715 CAGGTCAGGAATTTTGTACAGGG + Intergenic
967682686 3:192383357-192383379 CAGCACATGAATATTATAAAGGG - Intronic
969677202 4:8620716-8620738 CAGCAGATGAATTTTGTGGGAGG + Intergenic
969678155 4:8626355-8626377 CAGCAGATGAATTTTGTGGGAGG + Intergenic
969679110 4:8631992-8632014 CAGCAGATGAATTTTGTGGGAGG + Intergenic
970232404 4:13924392-13924414 CAGCAAAAGAATATTGTGCAAGG + Intergenic
970559084 4:17265325-17265347 CAACATATGAATTTGGGGCAGGG + Intergenic
970786462 4:19803277-19803299 CAACATATGAATTTGGTAGCAGG + Intergenic
971245351 4:24922193-24922215 CAGCATATGAATTTGGGAGGAGG + Intronic
972650428 4:41012360-41012382 CAGGATATGAATTCTCTAAATGG + Intronic
974015779 4:56647586-56647608 CAACATATGAATTTTGTTGGGGG + Intergenic
974642189 4:64645593-64645615 CAGCATTAGAAGTTAGTACATGG - Intergenic
974840331 4:67292029-67292051 CAGAATATCAATTTTATACAAGG - Intergenic
975657895 4:76659937-76659959 CAGCATATGCATGTTTTAGATGG - Intronic
977751631 4:100616650-100616672 CAACATATGAATTTGGGAAAGGG + Intronic
979983924 4:127292246-127292268 TAACATATGAATTTTGGAGAAGG - Intergenic
980598240 4:134984728-134984750 CAGCATATACATTTTGGGCAGGG - Intergenic
981665105 4:147215406-147215428 CAGCATATAAATTTTGAAGAGGG - Intergenic
981872549 4:149504496-149504518 CAACATATGAATTTGTCACAGGG - Intergenic
983165693 4:164474679-164474701 CAGCACATGAATTATATTCAAGG - Intergenic
985090949 4:186362272-186362294 CAACATATGAAGTTTGGAGAAGG - Intergenic
986762266 5:10891081-10891103 CAACATATGAATTTTGGAGGAGG - Intergenic
986783059 5:11084776-11084798 CAGCATTTTTATTTTATACAGGG + Intronic
987221565 5:15795654-15795676 CAGCTTATGGATTTTGTTCATGG + Intronic
987749493 5:22020830-22020852 CAACATATGAATTTTGGGGAGGG + Intronic
988127405 5:27058907-27058929 CAAAATATCAATTTTGTCCAGGG + Intronic
988129714 5:27087435-27087457 ATGCATATGAATTTCTTACATGG - Intronic
989970429 5:50518149-50518171 CAGCACATGAATTATTTTCAAGG - Intergenic
993191034 5:84681439-84681461 CAGCATATGAATATTTTAGGTGG - Intergenic
993778806 5:92039332-92039354 CATCATATTAATTTTGTTTATGG - Intergenic
993972864 5:94441481-94441503 CAACATATGAATTTTGAGGAGGG - Intronic
994356133 5:98795699-98795721 TAGCTTCTGAATTTGGTACATGG - Exonic
994893303 5:105667661-105667683 CAGCATATGAATTATTGTCAAGG - Intergenic
995565416 5:113429127-113429149 CAGCATATGAATTTGGGAAGGGG - Intronic
995746486 5:115409258-115409280 CAACATATGAATTTAGTGGAGGG + Intergenic
996022269 5:118604422-118604444 CAGGATATGAATTTTGTGTAAGG - Intergenic
996041294 5:118815477-118815499 GATCATATGAATTTTGTTCTTGG - Intergenic
996178294 5:120387244-120387266 CAACATATGAATTTTGTTTGGGG + Intergenic
996487325 5:124052252-124052274 CAACACCTGAATTTTGTAGAGGG - Intergenic
996595258 5:125194037-125194059 CAGTATAAGAATTTTTTAAATGG + Intergenic
998195229 5:140063292-140063314 CAGCAAAAGAAGTATGTACAAGG + Intergenic
998452342 5:142244693-142244715 CAGCATATGAATTGTGTTTGGGG + Intergenic
998775017 5:145590002-145590024 CTACATATGAATTATGTACTAGG + Intronic
1000875718 5:166635571-166635593 CAGCCTAAGAATTTAGAACAAGG + Intergenic
1003118570 6:3300368-3300390 CAACATATGAATTTGGGCCAGGG - Intronic
1003142195 6:3480939-3480961 CAGCATATGAATTTGGGAGGGGG + Intergenic
1005037607 6:21571072-21571094 CAGCAAATGATTTCTGTAAAGGG - Intergenic
1005226892 6:23653605-23653627 CAACATATGAATTTTGTGGGGGG - Intergenic
1007226516 6:40319236-40319258 CTGCATATGAATTTTGGAAGGGG - Intergenic
1008962749 6:57282527-57282549 CAACATATGAATTTGGTGGAGGG - Intergenic
1008999387 6:57696083-57696105 CAGCAGATCAATATTCTACATGG + Intergenic
1009187875 6:60595488-60595510 CAGCAGATCAATATTCTACATGG + Intergenic
1010380345 6:75216833-75216855 CAACATATGAATTTGGGAGATGG + Intergenic
1010974473 6:82296897-82296919 CAGCATATGAATTTGGAAGGGGG + Intergenic
1011019730 6:82798962-82798984 CAGCATATAAATTTTGGAGTTGG - Intergenic
1012935677 6:105364929-105364951 CAGCACATGCCTTTGGTACATGG + Intronic
1013538028 6:111081272-111081294 CAACATATGAATTTTGGGGATGG + Intergenic
1013940173 6:115651552-115651574 CAACATATGAATTTGGAACTGGG + Intergenic
1014553572 6:122817736-122817758 CAGCATATGAATTTTCAAGGGGG + Intergenic
1015151533 6:130044641-130044663 CAGCACATGAATTGGATACATGG - Intronic
1015507916 6:134008264-134008286 CAGCAGATGTTTTTTCTACAGGG - Intronic
1016367609 6:143336591-143336613 CAGCATATGAATTTGGAAGTGGG + Intronic
1016732645 6:147443130-147443152 CAACATATGAATATTGGAGAGGG - Intergenic
1017087307 6:150725327-150725349 CAACATATGAATTTTGAGAAGGG + Intronic
1017345479 6:153374965-153374987 CAGCATATAAAATAAGTACATGG + Intergenic
1017386234 6:153887490-153887512 CAGCTTATAAAGTTTATACAAGG - Intergenic
1017958709 6:159203213-159203235 CAACATATGAATTTGGCAGAGGG + Intronic
1020342664 7:7129424-7129446 CAGCACATGCAACTTGTACAAGG + Intergenic
1020723962 7:11785472-11785494 CAGCATTTCCATTTTGTAAAGGG + Intronic
1021599821 7:22354562-22354584 CAACATAAGAATTTTGTAGGGGG - Intronic
1022040577 7:26577660-26577682 CAACAGATGAATTTTGAGCAGGG + Intergenic
1023989575 7:45120276-45120298 CAACATATGAATTTTGGAAGAGG + Intergenic
1024341295 7:48264340-48264362 CAGTTTGTGAATTTTGTAAAAGG - Intronic
1026760894 7:73125005-73125027 CAGCAGGTGAAATTTGTGCAGGG + Intergenic
1027086326 7:75267651-75267673 CAGCAGGTGAAATTTGTGCAGGG - Intergenic
1030138104 7:106277866-106277888 AAGCAGATAAATTTTTTACATGG - Intronic
1030214653 7:107032063-107032085 CAACATATGAATTTGGAGCAAGG - Intergenic
1030924576 7:115436084-115436106 CAGCATTTGAACTTTTTAAATGG - Intergenic
1031051025 7:116945872-116945894 TAGCATATGATTTTTGTATTTGG + Intergenic
1031126136 7:117775257-117775279 CACAAGATGAATTTTGGACAAGG - Intronic
1031607213 7:123783554-123783576 CAGCATTTTAATTTTTTTCAAGG - Intergenic
1033363216 7:140652580-140652602 CAACATATGAATTTTGGAGGCGG - Intronic
1036450684 8:8864463-8864485 TAGGATATGAATTTGGTCCAAGG - Intronic
1036684966 8:10903508-10903530 CAGCATATGGATTTTGTGGGGGG - Intronic
1037669387 8:21001287-21001309 CAACATATGAATTTTGGAATGGG - Intergenic
1038294387 8:26277600-26277622 CAGCATATGAAGTTGGTTCTGGG + Intergenic
1039411759 8:37360720-37360742 CAGCATATGAATCTTTTAGCCGG - Intergenic
1040520681 8:48173469-48173491 CAGCATATGAGTTTTGTTGGAGG + Intergenic
1041657127 8:60363998-60364020 CAGCATATGAATTTTGAGGAAGG + Intergenic
1042338743 8:67656720-67656742 TAGCATATGACTTCTTTACAAGG - Intronic
1043783399 8:84365752-84365774 CAGAAAATGAATTTTTTAGAAGG + Intronic
1044297849 8:90549055-90549077 AAGCATATAAATTTTGTGTAGGG - Intergenic
1044402191 8:91785788-91785810 AAGCATAAGAATTTGGTAGATGG + Intergenic
1047256564 8:123217687-123217709 CAGCATCTTAATTTTGCAAAAGG - Intergenic
1048913045 8:139154586-139154608 CAGAATAAGAATTTTATACCAGG - Intergenic
1049723641 8:144134521-144134543 CAGCATATGCATTTTTTGGAGGG + Intergenic
1053332281 9:37224112-37224134 CAGTATATTAATTTTTTAAAAGG + Intronic
1053439131 9:38100950-38100972 CTGCAAGTGAATTTTGTATATGG - Intergenic
1055799192 9:80014222-80014244 CAGCATATCAACTATTTACATGG - Intergenic
1056410008 9:86316210-86316232 CAGCATTTCAATTCTGTGCATGG + Intronic
1059890549 9:118797153-118797175 CAGCAAATGAGTTTTGTTCTTGG - Intergenic
1185917096 X:4047605-4047627 CAACATATGAATTTGGACCAAGG - Intergenic
1186011779 X:5142504-5142526 CTGCATATGCATTTTGCAGAAGG + Intergenic
1186368473 X:8921260-8921282 CAGTATAACAATTATGTACATGG + Intergenic
1188855047 X:35184039-35184061 CAACATATGAATTTTGGAGGGGG - Intergenic
1188929424 X:36088180-36088202 CAACATATGAACTTTGTGGAGGG + Intronic
1188953782 X:36409647-36409669 CAGCATATGAATTATTCCCAAGG - Intergenic
1189211842 X:39290416-39290438 CAACATATGAATTTGGTAGGGGG + Intergenic
1191217031 X:57943454-57943476 CGGCATATGGATTTTATATATGG + Intergenic
1194602989 X:95946589-95946611 CAGCATATGTATTTTGTAGAAGG - Intergenic
1194789753 X:98132496-98132518 CCTTATATGAATTTTGTCCAGGG - Intergenic
1195406063 X:104514519-104514541 CAGCATATGAATTTGGGGCGGGG + Intergenic
1196381671 X:115098133-115098155 CAACATATGAATTTTGGAGGTGG - Intergenic
1197489094 X:127094660-127094682 CAACATATGAATTCTGGGCAGGG + Intergenic
1197823261 X:130563063-130563085 CAACATATGAATTTGGGAGATGG + Intergenic
1198670227 X:139072092-139072114 CAGCATATGAATTTTGGGGAGGG - Intronic
1199671019 X:150148459-150148481 CAACATATCAATTTGGTAGAAGG + Intergenic
1199817655 X:151412977-151412999 CAACATATGAATTTTTTAGAGGG + Intergenic
1201484077 Y:14473663-14473685 CAGCATATGAATTTTTTTTGTGG - Intergenic