ID: 1070373014

View in Genome Browser
Species Human (GRCh38)
Location 10:75803400-75803422
Sequence TTCACCCTGTTACCAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 475}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070373014_1070373020 2 Left 1070373014 10:75803400-75803422 CCTGTTCTTGGTAACAGGGTGAA 0: 1
1: 0
2: 0
3: 20
4: 475
Right 1070373020 10:75803425-75803447 CTGGGGTAACAAGTCCTGCCGGG No data
1070373014_1070373021 15 Left 1070373014 10:75803400-75803422 CCTGTTCTTGGTAACAGGGTGAA 0: 1
1: 0
2: 0
3: 20
4: 475
Right 1070373021 10:75803438-75803460 TCCTGCCGGGAGACTGTAAGAGG No data
1070373014_1070373019 1 Left 1070373014 10:75803400-75803422 CCTGTTCTTGGTAACAGGGTGAA 0: 1
1: 0
2: 0
3: 20
4: 475
Right 1070373019 10:75803424-75803446 GCTGGGGTAACAAGTCCTGCCGG No data
1070373014_1070373024 23 Left 1070373014 10:75803400-75803422 CCTGTTCTTGGTAACAGGGTGAA 0: 1
1: 0
2: 0
3: 20
4: 475
Right 1070373024 10:75803446-75803468 GGAGACTGTAAGAGGTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070373014 Original CRISPR TTCACCCTGTTACCAAGAAC AGG (reversed) Intronic
900148557 1:1168552-1168574 TTCCCCCAGTCAACAAGAACAGG + Intergenic
903486873 1:23696091-23696113 TTCTCCCTGTCACCATGAATGGG + Intronic
903873230 1:26452453-26452475 TCCACCGTGTTACCTTGAACGGG + Intronic
904006899 1:27367662-27367684 TGGACCCTGAAACCAAGAACTGG + Intergenic
907395721 1:54188521-54188543 CTCTCCATGTTACCAAAAACAGG + Intronic
907715417 1:56921889-56921911 ATCTCCCTGGGACCAAGAACTGG - Intergenic
908537933 1:65095813-65095835 ATCACCCTGATACCAAAACCAGG - Intergenic
908867282 1:68563267-68563289 ATCACCCTGATACCAAAATCAGG - Intergenic
909043626 1:70684056-70684078 ATCACCCTGATACCAAAACCAGG - Intergenic
909285359 1:73809649-73809671 ATCACCCTGATACCAAAATCTGG - Intergenic
909303649 1:74045121-74045143 ATCATCCTGATACCAAGACCTGG + Intronic
909397349 1:75185262-75185284 ATCACCCTGATACCAAAACCTGG + Intergenic
911504341 1:98729919-98729941 ATCACCCTGATACCAAAACCTGG + Intronic
912608905 1:111022660-111022682 ATCACCCTGATACCAAAATCTGG + Intergenic
912897062 1:113603514-113603536 ATCACCCTGATACCAAAACCGGG + Intronic
913309775 1:117477297-117477319 ATCACCCTGTTACCAAAACCTGG + Intronic
915002119 1:152603165-152603187 TTCACCGTCTTCCCAGGAACAGG - Intergenic
915756811 1:158269150-158269172 TTCACCCTGATACCAAAACCAGG + Intergenic
915844063 1:159244078-159244100 ATCACCCTGATACCAAAACCAGG - Intergenic
916566068 1:165979078-165979100 ATCACCCTATTACCAAAACCAGG - Intergenic
916872865 1:168936309-168936331 ATTACCCTGTTACCAAAACCAGG - Intergenic
917221356 1:172732136-172732158 ATCACCCTGATACCAAAATCAGG + Intergenic
917467211 1:175290947-175290969 ATCACCCTGATACCAAAATCTGG + Intergenic
918051201 1:180974018-180974040 TTCACCCTGTGTCCTAGAATGGG - Exonic
918172193 1:182008887-182008909 ATCACCCTGATACCAAAACCAGG + Intergenic
918696997 1:187557214-187557236 ATCACCCTGATACCAAAACCTGG - Intergenic
918786706 1:188772519-188772541 ATCACCCTGATACCAAAACCTGG + Intergenic
918966418 1:191355184-191355206 ATCACCCTGATACCAAAACCCGG - Intergenic
919146451 1:193641900-193641922 ATCACCCTGATACCAAAACCTGG - Intergenic
919901980 1:202050620-202050642 TTCACCGTGTTAGCCAGGACGGG - Intergenic
921010929 1:211140185-211140207 ATCACCCTGATACCAACACCTGG - Intergenic
921104598 1:211963501-211963523 ATCACCCTGATACCAAAACCTGG + Intronic
921409653 1:214822176-214822198 TTCACCCTAATACCAAAACCAGG - Intergenic
921877352 1:220213520-220213542 TTCACATTGTTACTAAGAAAAGG + Intronic
921895955 1:220400872-220400894 ATCACCCTGATACCAAAAACTGG - Intergenic
923345617 1:233049147-233049169 ATCACCCTGATACCAAAATCTGG + Intronic
923657292 1:235928898-235928920 ATCACCCTGATACCAAAACCAGG - Intergenic
923707235 1:236353806-236353828 TTCTACCTTTTACCCAGAACAGG + Intronic
924633144 1:245761249-245761271 TTCACCTTGGTACCAAGAATAGG + Intronic
924952789 1:248900247-248900269 ATCATCCTGATACCAAGACCTGG + Intergenic
1064556926 10:16556224-16556246 ATCACCCTAATACCAAAAACAGG - Intergenic
1064642172 10:17426150-17426172 TTCACTCTGTTCCCAAGTGCTGG + Intronic
1065156916 10:22879745-22879767 ATCACCCTGATACCAAAACCAGG - Intergenic
1065465125 10:26011772-26011794 ATCACCCTGATACCAAAAGCTGG + Intronic
1067256065 10:44643286-44643308 TTCATCCTGATACCAAAACCTGG + Intergenic
1068260938 10:54580607-54580629 ATCACCCTGATACCAAAACCTGG + Intronic
1068372004 10:56129301-56129323 ATCACCCTGATACCAAAACCTGG + Intergenic
1070373014 10:75803400-75803422 TTCACCCTGTTACCAAGAACAGG - Intronic
1071894226 10:90047562-90047584 ATCACCCTGATACCAAAACCTGG - Intergenic
1073822538 10:107281367-107281389 ATCACCCTGATACCAAAACCTGG - Intergenic
1074153314 10:110777865-110777887 ATCGCCTTGTTAGCAAGAACAGG + Intronic
1074664335 10:115701957-115701979 ATCACCCTGATACCAAAACCTGG + Intronic
1078651547 11:13199411-13199433 ATCACCCTGATACCAAAAACTGG + Intergenic
1078993590 11:16673766-16673788 ATCACCCTGATACCAAAACCAGG + Intronic
1079267381 11:18946811-18946833 TTCATCCTGATACCAAAACCTGG + Intergenic
1079474681 11:20817120-20817142 ATCACCCTGATACCAACATCTGG - Intronic
1079791372 11:24744192-24744214 ATCACCCTATTACCAAAACCAGG - Intronic
1080118272 11:28644931-28644953 ATCATCCTGTTACCAAAACCTGG + Intergenic
1080845779 11:36025585-36025607 TTCACCCTGTTAGCCAGGATGGG + Intronic
1081379547 11:42398028-42398050 TTCATCCTGATACCAAAACCTGG + Intergenic
1083515898 11:63258301-63258323 ATCATCCTGATACCAAGATCTGG - Intronic
1083519365 11:63293782-63293804 TTCATCCTGATACCAAAACCTGG - Intronic
1086844272 11:91729677-91729699 GTCACCCTGATACCAAAACCAGG + Intergenic
1087306089 11:96490609-96490631 ATCATCCTGTTACCAAAACCTGG + Intronic
1088077971 11:105875395-105875417 ATCATCCTGTTACCAAAACCTGG - Intronic
1090087097 11:123659993-123660015 TTCACACTGCTATAAAGAACTGG + Intergenic
1090200056 11:124847546-124847568 TTCACCCTAATACAAACAACTGG + Intergenic
1090483766 11:127092925-127092947 ATCACCCTGATACCAAAATCTGG + Intergenic
1091653486 12:2326696-2326718 TTCACCCTGTTCTCAAGGCCTGG + Intronic
1092320188 12:7464007-7464029 ATCATCCTGATACCAAAAACTGG - Intronic
1092643189 12:10538996-10539018 ATCACCCTAATACCAAGATCTGG + Intergenic
1092678987 12:10956092-10956114 ATCACCCTGATACCAAAACCAGG + Intronic
1093327665 12:17799224-17799246 TTCACCCTGATACCAAAGCCAGG + Intergenic
1094122857 12:26992480-26992502 TTCACCCTGTTAGCCAGGATGGG + Intronic
1094434517 12:30406650-30406672 ATCACCCTGATACCAGGACCTGG - Intergenic
1094789558 12:33896008-33896030 ATCACCCTAATACCAAGACCAGG + Intergenic
1095146892 12:38740871-38740893 TTCACCCTGATACCAAAGCCTGG - Intronic
1095747830 12:45679080-45679102 TTCATCACGTTACCAAGAACTGG + Intergenic
1095867553 12:46989283-46989305 ATCACCCTGATACCAAAACCTGG + Intergenic
1095908250 12:47399491-47399513 ATCACCCTGATACCAAAACCTGG + Intergenic
1097337503 12:58399430-58399452 ATCACCCTGATACCAAAACCTGG - Intergenic
1097620701 12:61936014-61936036 ATCACCCTGATACCAAAACCAGG + Intronic
1098145477 12:67493320-67493342 ATCACCCTGATACCAAAACCTGG + Intergenic
1098156348 12:67603010-67603032 TTCACCAAGTTTACAAGAACTGG + Intergenic
1098791529 12:74830159-74830181 ATCACCCTGATACCAAAACCTGG - Intergenic
1098906310 12:76166358-76166380 ATCACCCTGATACCAAAACCTGG - Intergenic
1099463847 12:82958035-82958057 ATCACCCTGATACCAAAACCTGG + Intronic
1099549038 12:84020158-84020180 ATCATCCTGATACCAAAAACAGG + Intergenic
1099875242 12:88396392-88396414 ATCACCCTGGTACCAAAATCAGG + Intergenic
1099897860 12:88671114-88671136 ATCACCCTGATACCAAAACCTGG + Intergenic
1100156715 12:91808125-91808147 ATCACCCTGATACCAAAACCTGG + Intergenic
1105315224 13:19253258-19253280 ATCACCCTAATACCAAAAACAGG + Intergenic
1105569916 13:21592521-21592543 ATCATCCTGATACCAAGATCAGG + Intronic
1105865339 13:24453917-24453939 TTCACCCTGTTGACCAGAGCTGG - Intronic
1106751596 13:32776021-32776043 TTTACACTGTTACGGAGAACTGG - Exonic
1107389482 13:39948523-39948545 ATCACCCTGTTACCCAAACCTGG + Intergenic
1107641463 13:42447699-42447721 ATCACCCTGATACCAAAACCTGG + Intergenic
1107656081 13:42593006-42593028 TTCACACTGCTATAAAGAACTGG - Intronic
1108019974 13:46118068-46118090 TTCACTCTGGGACAAAGAACAGG + Intergenic
1108865215 13:54914813-54914835 ATCACCCTGATACCAAAACCTGG + Intergenic
1109020320 13:57082816-57082838 ATCACCCTGGTACCAAAACCTGG - Intergenic
1109563773 13:64083581-64083603 ATCAGCCTGGTACCAAGAGCTGG + Intergenic
1109567783 13:64140792-64140814 ATTACCCTGATACCAAAAACAGG + Intergenic
1109891551 13:68620740-68620762 ATCACCCTGATACCAAAACCTGG + Intergenic
1110246513 13:73331219-73331241 TTCACCGTGGTACAGAGAACTGG + Intergenic
1111080830 13:83305029-83305051 ATCATCCTGTTACCAAAACCTGG + Intergenic
1112396650 13:99039690-99039712 CTCATTCTGTTACCAAGAATGGG - Intronic
1112595690 13:100804922-100804944 TTCTCCCAGTTCCCAAGAGCTGG - Intergenic
1112860701 13:103826755-103826777 ATCATCCTGATACCAAAAACTGG - Intergenic
1113986356 13:114319461-114319483 TACAGCCTGATACCAAAAACAGG - Intronic
1115974059 14:38977670-38977692 ATCATCCTGTTACCAAAACCTGG - Intergenic
1116752763 14:48907558-48907580 TGCAACCTGGTACCAAGTACAGG + Intergenic
1117088751 14:52228033-52228055 TTCACCTTGTAACCAAACACAGG - Intergenic
1117178218 14:53166830-53166852 ATCACCGTGTTACCCAGAACAGG - Intergenic
1117716035 14:58582372-58582394 ATCATCCTGATACCAAAAACTGG - Intergenic
1117786080 14:59286943-59286965 ATCACCCTGATACCAAAGACTGG + Intronic
1120338313 14:83187782-83187804 ATCACCCTGATACCAAAACCTGG - Intergenic
1120597477 14:86459171-86459193 TTCAGTCAGTTACCAAGTACAGG + Intergenic
1120725096 14:87929985-87930007 ATCATCCTGATACCAAAAACTGG + Intronic
1120748192 14:88172010-88172032 ATCATCCTGTTACCAAAATCTGG + Intergenic
1120934005 14:89875575-89875597 TTTACCCAGTTACCCATAACTGG - Intronic
1121384388 14:93505229-93505251 TTCTATCTGTTACCAAGAGCAGG + Intronic
1121470396 14:94149138-94149160 ATCACCCTGATACCAAAACCTGG - Intronic
1121479188 14:94247575-94247597 ATCACCCTGATACCAAAATCTGG + Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1124704075 15:31946660-31946682 ATCACCCTGATACCAAAATCTGG + Intergenic
1126098294 15:45104566-45104588 TTCTCCCTGGGCCCAAGAACCGG + Intronic
1126355622 15:47792754-47792776 TTCTCCCTGTCACTAAGAAATGG + Intergenic
1126505820 15:49403247-49403269 ATCATCCTGATACCAAGACCTGG - Intronic
1126873979 15:53018797-53018819 ATCACCCTGATACCAAAACCTGG - Intergenic
1126976072 15:54182491-54182513 ATCACCCTGATACCAAAACCTGG - Intronic
1131646353 15:94349389-94349411 TTCACCCTGTATCCAAGGACAGG - Intronic
1131719881 15:95156412-95156434 GTCTCACTGTTCCCAAGAACGGG + Intergenic
1133096200 16:3447906-3447928 TTAATTCTGTTACCAAAAACTGG + Intronic
1133097939 16:3459997-3460019 AGCACCCAGTTAGCAAGAACAGG - Intronic
1133868273 16:9664136-9664158 GTCACCCTGTTACCAAGTCAGGG - Intergenic
1134298636 16:12969546-12969568 TTCACCATGTTACCCAGGGCTGG - Intronic
1136645032 16:31606513-31606535 ATCACTCTGTTACCAAAATCTGG + Intergenic
1136660204 16:31751270-31751292 ATCACTCTGTTACCAAAATCTGG - Intronic
1138000788 16:53277267-53277289 ATCACCCTGATACCAAAACCAGG + Intronic
1138028742 16:53542368-53542390 TTCACGGTGTTAACAAGAATGGG + Intergenic
1138192402 16:55025438-55025460 ATCACCCTGATACCAAAACCAGG + Intergenic
1138976716 16:62216608-62216630 ATCATCCTGATACCAAAAACTGG - Intergenic
1139169317 16:64612009-64612031 ATCACCCTGATACCAAAACCTGG - Intergenic
1140608766 16:76572795-76572817 TTCACCGTGTTACCCAGGATGGG + Intronic
1143662134 17:8331871-8331893 TTTACTGTGTGACCAAGAACAGG + Intergenic
1144192632 17:12860517-12860539 TTCACCATGTTGCCTAGCACTGG - Intronic
1144642784 17:16947120-16947142 TTCACTCTGGTACCAAAACCTGG + Intronic
1146074822 17:29718533-29718555 TTCACCGTGTTAGCCAGGACGGG - Intronic
1146207609 17:30918397-30918419 TTCACCGTGTTGCCCAGACCGGG + Intronic
1147406546 17:40216518-40216540 TTCACCATGTTACCCAGGATGGG - Intergenic
1147726923 17:42571604-42571626 TTCTCCAGGTTTCCAAGAACCGG - Exonic
1148192601 17:45690116-45690138 TTCAGCCTCTCTCCAAGAACCGG - Intergenic
1148402851 17:47382764-47382786 ATCACCCTGATACCAAAACCAGG - Intronic
1148768006 17:50050613-50050635 TTGACCCTGTTTCCAACCACAGG + Intergenic
1149044961 17:52234386-52234408 TTCTCCTTGGTACCAAGCACAGG + Intergenic
1149090017 17:52766777-52766799 ATCACCCTGATACCAAAATCAGG + Intergenic
1149247763 17:54731359-54731381 ATCATCCTGATACCAAAAACTGG + Intergenic
1149366381 17:55949450-55949472 ATCATCCTGATACCAAAAACTGG - Intergenic
1149405177 17:56341786-56341808 ATCACCCTGATACCAAAACCTGG - Intronic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1153291608 18:3507167-3507189 TTCTCCTTGTTAACAAGAAGTGG + Intronic
1153349655 18:4064838-4064860 ATCACCCTGATACCAAAACCTGG + Intronic
1153531137 18:6047412-6047434 ATCACCCTGATACCAAAATCTGG + Intronic
1154403013 18:14060339-14060361 ATCACCCTGATACCAAAACCTGG - Intronic
1155024567 18:21929580-21929602 TCAAACCTGTCACCAAGAACAGG - Intergenic
1155764729 18:29614070-29614092 ATCATCCTGATACCAAGACCAGG - Intergenic
1156096091 18:33533952-33533974 TTCATCCTGATACCAAAATCTGG - Intergenic
1156543790 18:37943852-37943874 ATCACCCTGATACCAAAACCTGG + Intergenic
1156886850 18:42145019-42145041 CTCACCCTGATACCAAAATCTGG + Intergenic
1157063218 18:44318062-44318084 TTTACCCTGAACCCAAGAACAGG - Intergenic
1158331362 18:56366804-56366826 ATCACCCTGATACCAAAACCAGG - Intergenic
1158489442 18:57896616-57896638 TTCTCCCTGGTTCCCAGAACAGG + Intergenic
1160273194 18:77406805-77406827 TTTATCCTGTTTCCCAGAACAGG + Intergenic
1161150433 19:2705166-2705188 TTCACCGTGTTAGCCAGAATGGG + Intergenic
1161887568 19:7008662-7008684 TTCTCCCTGTTTCCCAGAGCAGG + Intergenic
1162089835 19:8271953-8271975 TTCAGGCTGATACCAAGAAGAGG + Intronic
1164008861 19:21178853-21178875 ATCACCCTGATATCAAGACCTGG - Intronic
1164085860 19:21901871-21901893 TTGGCTCTGTTACCTAGAACTGG + Intergenic
1164120394 19:22260555-22260577 TTGACCCTCATACCTAGAACTGG - Intergenic
1164299165 19:23944736-23944758 TTCACCCTGATACCAACATTAGG - Intronic
1164422679 19:28109985-28110007 ATCACCCTGATACTAAAAACAGG + Intergenic
926501578 2:13660214-13660236 ATCACCCTGATACCAAAACCTGG - Intergenic
926797857 2:16633588-16633610 TTCACCATGTTGCCAAGGGCTGG + Intronic
927559906 2:24062737-24062759 TTCACCCTCTTCCAAAGAATAGG - Intronic
928503123 2:31919155-31919177 TTCACCCTGTCACCCAGGCCAGG + Intronic
928815373 2:35288483-35288505 ATCACCCTGATACCAAAACCAGG - Intergenic
930061895 2:47296681-47296703 TTCACCATGTTGCCCAGACCAGG - Intergenic
931211756 2:60203809-60203831 ATCACCCTGATACCAAAACCTGG - Intergenic
932146121 2:69318890-69318912 CTCACCCTCTTCCCAAGAAGAGG - Intergenic
932473409 2:71980709-71980731 ATCACCCTGATACCAAAACCAGG + Intergenic
934152896 2:89165763-89165785 ATCACCCTGATACCAAAACCTGG - Intergenic
935567617 2:104626200-104626222 ATCACCCTGATACCAAAACCTGG - Intergenic
935711120 2:105899580-105899602 ATCACCCTGATACCAAAACCTGG - Intergenic
935932324 2:108141106-108141128 ATCACCCTGATACCAAAACCTGG + Intergenic
937188633 2:120070491-120070513 ATCATCCTGTTACCAAAACCTGG + Intronic
937920788 2:127128604-127128626 TTCATCCTGTTGGCCAGAACTGG + Intergenic
938216262 2:129519342-129519364 ATCACCCTGATACCAAAACCAGG - Intergenic
938217307 2:129530030-129530052 ATCATCCTGATACCAAGACCTGG + Intergenic
938221489 2:129572489-129572511 ATCACCCTGATACCAAAACCTGG + Intergenic
938537654 2:132258310-132258332 TTCACCATGTTGCCAAGGCCTGG - Intergenic
939557396 2:143692415-143692437 TTCACCCAGTTCCCCAGAAAAGG + Intronic
940157092 2:150668987-150669009 ATCACCCTGATACCAAAACCAGG + Intergenic
940303046 2:152195929-152195951 ATCATCCTGATACCAAAAACTGG + Intergenic
940326579 2:152431932-152431954 TTCACTCTGTTGCCCAGACCAGG - Intronic
940365955 2:152849125-152849147 ATCACCCTGATACCAAAACCAGG - Intergenic
940417757 2:153442427-153442449 ATCATCCTGATACCAAAAACTGG - Intergenic
940706552 2:157112017-157112039 ATCACCCTGATACCAAAACCAGG + Intergenic
941445542 2:165594321-165594343 TTCTCCATTTTACCATGAACTGG - Intronic
942628689 2:177932317-177932339 ATCACCCTGATACCAAAACCTGG + Intronic
943611655 2:190041998-190042020 ATCACCCTGATACCAAAACCTGG - Intronic
944392533 2:199231731-199231753 ATCACCCTGTTACCAAAACCTGG - Intergenic
944788831 2:203102788-203102810 ATCACCCTGATACCAAAACCTGG - Intronic
944922075 2:204425496-204425518 ATCATCCTGATACCAAGACCTGG + Intergenic
945329398 2:208522033-208522055 ATCACCCTGATACCAAAACCTGG - Intronic
945337800 2:208613514-208613536 ATCACCCTAATACCAAAAACAGG - Intronic
946593304 2:221275867-221275889 TTCACGTTATTACCAAGAAGGGG + Intergenic
946824349 2:223661326-223661348 ATCACCCTATTACCAAAACCAGG + Intergenic
946970852 2:225089417-225089439 TTCACTCTTATACCAAGAAAAGG + Intergenic
947086354 2:226457376-226457398 ATCATCCTGTTACCAAAACCTGG + Intergenic
947322206 2:228932947-228932969 ATCACCCTGATACCAAAACCTGG - Intronic
947378785 2:229524751-229524773 TTCACCCTTTTACCTGGACCAGG - Intronic
947453345 2:230229187-230229209 TTCACAATGTTAAAAAGAACAGG - Intronic
947733364 2:232442828-232442850 TTCAATCTGTTCACAAGAACTGG + Intergenic
948146171 2:235709698-235709720 TTTACCCTGTGACCAAGTATTGG + Intronic
948437531 2:237964095-237964117 GTCCCCCTGTTACCAAAAAGGGG + Intergenic
1168740363 20:185050-185072 ATCACCCTGGTACCAAAACCTGG + Intergenic
1169695335 20:8381424-8381446 ATCATCCTGTTACCAAAACCTGG - Intronic
1171459423 20:25290556-25290578 TTCAACCTGTCACCCACAACTGG - Exonic
1173091016 20:39971619-39971641 TTCATCCTGATACCAAAACCTGG - Intergenic
1173798831 20:45881875-45881897 TTCACTCTGTCACCCAGAGCTGG + Intronic
1175789095 20:61730680-61730702 TTCACCCTGGCTCCAAGCACAGG - Intronic
1176337381 21:5611589-5611611 TTCACTCTCATACCCAGAACCGG + Intergenic
1176471043 21:7106815-7106837 TTCACTCTCATACCCAGAACCGG + Intergenic
1176494604 21:7488593-7488615 TTCACTCTCATACCCAGAACCGG + Intergenic
1176506038 21:7649790-7649812 TTCACTCTCATACCCAGAACCGG - Intergenic
1177329125 21:19633283-19633305 ATCACCCTATTACCAAAACCAGG + Intergenic
1177511018 21:22088490-22088512 ATCATCCTGTTACCAAAACCTGG - Intergenic
1177981789 21:27924321-27924343 ATCACCCTGATACCAAAACCAGG - Intergenic
1179083850 21:38199283-38199305 ATCACCCTATTACCAAAACCAGG - Intronic
1183867389 22:40714586-40714608 ATCCCCCTGCTGCCAAGAACGGG - Intergenic
949456080 3:4240250-4240272 TTCATCCTGATACCAAAACCTGG - Intronic
951194174 3:19804988-19805010 ATCACCCTGATACCAAAACCTGG + Intergenic
951740667 3:25919346-25919368 TTCACTCTGATACCAAAACCTGG - Intergenic
952111247 3:30126063-30126085 ATCATCCTGATACCAAAAACTGG - Intergenic
952194426 3:31058457-31058479 ATCACCCTGATACCAAAACCAGG - Intergenic
952972342 3:38659457-38659479 TTCACCCTGTTCCCATGGAAAGG - Intergenic
953110139 3:39927701-39927723 ATCACCCTGATACCAAAACCTGG + Intronic
955130559 3:56162359-56162381 ATCACCCTGATACCAAAACCTGG - Intronic
957442233 3:80264388-80264410 ATCACCCTGATACCAAAACCTGG - Intergenic
958264112 3:91417734-91417756 ATCACCCTGATACCAAAATCTGG + Intergenic
958444605 3:94199732-94199754 TTCACCCTAATACCAAAACCAGG - Intergenic
958826105 3:99033197-99033219 ATCACCCTGATACCAAAACCTGG + Intergenic
960476803 3:118140394-118140416 TTCATCCTGATACCAAAATCAGG - Intergenic
960524738 3:118696550-118696572 ATCAGCCTAATACCAAGAACGGG + Intergenic
960758440 3:121046340-121046362 TTCATCCTGATACCAAAACCTGG - Intronic
960776859 3:121266138-121266160 ATCACCCTGATACCAAAACCTGG + Intronic
961367714 3:126411401-126411423 ATCACCCTGATACCAAAACCAGG - Intronic
962322780 3:134405664-134405686 TTGACCCTGCCGCCAAGAACGGG - Intergenic
962333446 3:134502305-134502327 ATCACCCTGATACCAAAATCTGG - Intronic
962445915 3:135465039-135465061 ATCATCCTGATACCAAAAACTGG + Intergenic
964462557 3:156951341-156951363 ATCATCCTGATACCAAGACCTGG - Intronic
965345445 3:167543300-167543322 ATCACCCTGATACCAAAAACAGG + Intronic
965709221 3:171539449-171539471 TTTACCCTGATACCAAAACCAGG - Intergenic
965855756 3:173086016-173086038 ATCACCCTGATACCAAAACCTGG - Intronic
967741284 3:193005213-193005235 ATCACCCTGATACCAAAACCAGG - Intergenic
967949805 3:194832071-194832093 TTCACCATGTTAGCCAGGACGGG + Intergenic
969123548 4:4928256-4928278 TTCATCCTGATACCAAAACCTGG + Intergenic
970266229 4:14289838-14289860 ATCACCCTGATACCAAAACCTGG + Intergenic
970575663 4:17424279-17424301 TTCACACTGCTATAAAGAACTGG - Intergenic
971062021 4:22982773-22982795 ATCACCCTGATACCAAAACCAGG + Intergenic
971706209 4:30046891-30046913 TTCACCCTGATACCAAAGCCTGG + Intergenic
972261376 4:37411644-37411666 ATCACCCTTTTACCAAAACCTGG + Intronic
972858674 4:43139705-43139727 TTCATCCTGATACCAAAACCTGG - Intergenic
972989814 4:44811089-44811111 ATCACCCTGGTACCAAAAGCTGG - Intergenic
973003692 4:44984415-44984437 CTCACCCTGTCTCCAAGAATTGG + Intergenic
973081531 4:45999842-45999864 GTCATCCTGTTACCAAAACCTGG - Intergenic
975031206 4:69619660-69619682 ATCATCCTGTTACCAAAATCTGG + Intronic
975243522 4:72091312-72091334 TTCACCCTAATACCAAAACCAGG - Intronic
975290634 4:72674078-72674100 ATCACCCTGATACCAAAACCAGG - Intergenic
975375224 4:73636034-73636056 ATCACCCTGATACCAAAACCAGG + Intergenic
975418123 4:74130246-74130268 ATCACCCTGATACCAAAACCTGG + Intronic
975483845 4:74912696-74912718 ATCATCCTGTTACCAAAACCTGG - Intergenic
975610363 4:76196816-76196838 TTCATCCTGTAACACAGAACAGG - Intronic
975752932 4:77542845-77542867 ATCACCCTGATACCAAAACCTGG - Intronic
976446246 4:85132721-85132743 ATCACCCTGATACCAATACCTGG - Intergenic
976563282 4:86526049-86526071 ATCACCCTGATACCAAAATCTGG - Intronic
976640404 4:87331732-87331754 ATCACCCTGATACCAAAACCTGG - Intergenic
976651089 4:87435628-87435650 TTCTCCAGGTTACTAAGAACAGG + Intronic
976856771 4:89613439-89613461 ATCACCCTGATACCAAAACCAGG + Intergenic
976918423 4:90407513-90407535 ATCACCCTGATACCAAAACCAGG + Intronic
977515209 4:98013427-98013449 ATCACCCTGATACCAAAACCTGG - Intronic
977560940 4:98533170-98533192 ATCATCCTGTTACCAAAACCTGG - Intronic
977669035 4:99674442-99674464 TTCACCCTGATACCAAAACCAGG + Intergenic
977719192 4:100219496-100219518 TTTACCCTGATACCAAAACCAGG - Intergenic
977994789 4:103488410-103488432 ATCATCCTGTTACCAAAACCTGG + Intergenic
978340265 4:107714973-107714995 TTTACTCTGTTCCCAAGAACAGG - Intronic
978459999 4:108940883-108940905 TACACACTATTTCCAAGAACTGG - Intronic
978542688 4:109835990-109836012 TTCTCCCTATTATCAAGCACAGG - Exonic
979197517 4:117938280-117938302 ATCACCCTGATACCAAAACCTGG - Intergenic
979318380 4:119294735-119294757 TTCACCCAGTTACCAAGTCTTGG + Exonic
979554638 4:122031137-122031159 ATCATCCTGTTACCAAAACCTGG - Intergenic
979975085 4:127186072-127186094 GTCACCCTGATACCAAAACCAGG + Intergenic
980033709 4:127859818-127859840 ATCACCCTAATACCAAGACCAGG + Intergenic
980858696 4:138472398-138472420 ATCATCCTGATACCAAGACCTGG - Intergenic
981131907 4:141166452-141166474 TTCATCCTGATACCAAAACCTGG + Intronic
981346990 4:143687522-143687544 ATCACCCTATTACCAAAACCAGG + Intronic
981730956 4:147898049-147898071 TTCACCATGTTATCTAGAATGGG + Intronic
982119307 4:152125805-152125827 ATCACCCTGATACCAAAACCAGG - Intergenic
982593782 4:157351940-157351962 TTCATACTGTTACAAAGAACTGG - Intronic
982640402 4:157951276-157951298 TTCACTCTGTTCCCAAGTGCAGG + Intergenic
982845170 4:160243461-160243483 TTCACCCTGACACCAAAACCAGG - Intergenic
983051830 4:163057121-163057143 ATCACCCTGATACCAAAACCTGG - Intergenic
983371480 4:166864943-166864965 ATCACCCTGATACCAAAACCTGG + Intronic
983609977 4:169632066-169632088 TTCACCCCGATACCAAAACCTGG + Intronic
983821298 4:172196456-172196478 TTCATCCTGCTACCAAAACCTGG + Intronic
984283501 4:177700980-177701002 ATCATCCTGATACCAAGACCTGG - Intergenic
984494009 4:180472049-180472071 ATCATCCTGTTACCAATACCTGG + Intergenic
984805726 4:183749565-183749587 TTATCCCTGTTCCCTAGAACTGG - Intergenic
984944622 4:184961420-184961442 TTCACACAGTCACCAAGAAAAGG + Intergenic
985317770 4:188676366-188676388 ATCATCCTGTTACCAAAATCTGG + Intergenic
985974869 5:3409442-3409464 ATCACCCTGATACCAAAACCTGG - Intergenic
986369410 5:7065009-7065031 TTCACCGTGTTAGCCAAAACTGG + Intergenic
986563798 5:9090293-9090315 TTTACCCAGTAACCAAGCACTGG + Intronic
987669988 5:20994276-20994298 ATCACCCTGATACCAAAACCAGG + Intergenic
987724792 5:21684103-21684125 TTCAGCATGTTACCAAAAAAAGG - Intergenic
988068996 5:26263020-26263042 ATCACCCTGAAACCAAAAACTGG - Intergenic
988645959 5:33095309-33095331 ATCACCCTGATACCAAAACCTGG - Intergenic
988719540 5:33862703-33862725 ATCACCCTGATACCAAAACCTGG + Intronic
988719759 5:33865131-33865153 ATCACCCTGATACCAAAACCAGG + Intronic
989032496 5:37134121-37134143 ATCACCCTGATACCAAAACCTGG - Intronic
989299462 5:39872302-39872324 ATCACCCTGATACCAAAACCTGG - Intergenic
989362469 5:40618645-40618667 TTCACACCCTTACCAACAACTGG + Intergenic
989941784 5:50159646-50159668 ATCACCCTGATACCAAAGACGGG + Intergenic
990223963 5:53628362-53628384 ATCATCCTGATACCAAAAACTGG - Intronic
992260682 5:74967070-74967092 TTCCCCCTGTAACCAAACACAGG - Intergenic
992909051 5:81376999-81377021 ATCATCCTGATACCAAGACCTGG + Intronic
992976539 5:82126762-82126784 ATCACCCTGATACCAAAACCTGG - Intronic
992977374 5:82134705-82134727 ATCACCCTGATACCAAAACCTGG - Intronic
993694516 5:91045198-91045220 GTCACCCTGATACCAAGACCAGG + Intronic
994546400 5:101172097-101172119 TTCATCCTGATACCAAAACCTGG + Intergenic
994899321 5:105749752-105749774 GTCACCCTGATACCAAAACCTGG - Intergenic
995093583 5:108209791-108209813 ATCATCCTGTTACCAAAACCTGG - Intronic
995188300 5:109294186-109294208 ATCATCCTGTTACCAAAACCTGG + Intergenic
995529490 5:113078315-113078337 ATCATCCTGATACCAAAAACTGG + Intronic
995821956 5:116245500-116245522 ATCACCCTGATACCAAAACCTGG + Intronic
996697312 5:126412590-126412612 ATCACCCTGATACCAAAACCTGG - Intronic
997054042 5:130419279-130419301 ATCACCCTGATACCAAAACCTGG + Intergenic
998426663 5:142034647-142034669 TTCACCCTGTTGCCCAGGCCGGG + Intergenic
999666188 5:153916336-153916358 CTCACCCTGTTAGGAGGAACGGG + Intergenic
999719811 5:154391262-154391284 TTCTCTCTGTCACCAAGAAAAGG - Intronic
1000228408 5:159292386-159292408 ATCACCCTGATACCAAAACCTGG - Intergenic
1001060468 5:168484085-168484107 TTCATCATGCTACCAAGAAATGG - Intergenic
1005395038 6:25373240-25373262 ATCACCCTGATACCAAAACCAGG - Intronic
1006838782 6:37015029-37015051 AGCACCCTCTTACCAAGAAAAGG - Exonic
1009801146 6:68537820-68537842 ATCACCCTGATACCAAAACCTGG + Intergenic
1010459779 6:76101052-76101074 ATCACCCTGATACCAAAACCTGG + Intergenic
1010623882 6:78112116-78112138 GTCACCCTGATACCAAAACCTGG + Intergenic
1010647571 6:78410177-78410199 ATCACCCTATTACCAAAACCAGG + Intergenic
1011137727 6:84117936-84117958 TTCACCCAGTTAGGAGGAACGGG + Intergenic
1011147734 6:84237165-84237187 ATCACCCTGATACCAAAACCTGG + Intergenic
1011156358 6:84337624-84337646 ATCACCCTACTACCAAAAACAGG - Intergenic
1011214543 6:84991288-84991310 TTCATCCTGATACCAAAACCTGG + Intergenic
1011578556 6:88831098-88831120 ATCATCCTGATACCAAAAACTGG + Intronic
1011886729 6:92105929-92105951 ATCACCCTGGTACCAAAATCTGG - Intergenic
1012051772 6:94355138-94355160 TTAACCCTCTTAACAAAAACTGG + Intergenic
1012283532 6:97360309-97360331 TTCCCATTTTTACCAAGAACGGG + Intergenic
1012538024 6:100323016-100323038 ATCACCCTGATACCAAAACCTGG - Intergenic
1012811926 6:103969741-103969763 ATCACCCTGATACCAAAAACTGG + Intergenic
1013278720 6:108613222-108613244 ATTACCCTGGTACCAAAAACAGG - Intronic
1014065006 6:117114214-117114236 ATCACCCTGATACCAAAACCTGG + Intergenic
1014330482 6:120057777-120057799 ATCACCCTGATACCAAAACCTGG + Intergenic
1014864337 6:126509181-126509203 ATCACACTGATACCAAGACCTGG + Intergenic
1015349962 6:132206559-132206581 ATCACCCTGATACCAACACCTGG - Intergenic
1015541977 6:134323442-134323464 TTCACTATGTTAGCAAAAACAGG + Intergenic
1015677321 6:135764411-135764433 TTCACCATGCTAGCAAGAATGGG + Intergenic
1015906513 6:138123042-138123064 ATCACCCTGATACCAAAACCTGG + Intergenic
1017567449 6:155702763-155702785 ATCACCCTGATACCAAAACCTGG - Intergenic
1017698127 6:157039526-157039548 TTCACCTTGTTACCCAGGATGGG + Intronic
1018426969 6:163691805-163691827 TGCTCCCTGTTACCAAGAGAAGG - Intergenic
1019752151 7:2737646-2737668 TTCACACTGTGACCGAAAACAGG + Intronic
1020592137 7:10153262-10153284 ATCACCCTGATACCAAAATCAGG + Intergenic
1021323322 7:19238771-19238793 TTCATACTGTTATAAAGAACTGG + Intergenic
1021371713 7:19857243-19857265 ATCACCCTGATACCAAAACCTGG + Intergenic
1021466277 7:20947341-20947363 ATCACCCTGATACCAAAACCAGG + Intergenic
1022855768 7:34311971-34311993 TTCACCATGGTACCAAGAATTGG - Intergenic
1023497342 7:40812212-40812234 ATCACCCTGATACCAAAACCTGG - Intronic
1024327720 7:48124013-48124035 ATCACCCTATTACCAAAACCAGG - Intergenic
1024745048 7:52396635-52396657 ATCACCCTGATACCAAAACCAGG - Intergenic
1024950119 7:54852161-54852183 ATCATTCTGTTACCAAAAACTGG - Intergenic
1026299703 7:69086634-69086656 TTCAACCGGATACCAAGAAGAGG + Intergenic
1026493798 7:70885626-70885648 TTCACACTGTTACCAGAAAGGGG - Intergenic
1027495477 7:78882523-78882545 GTCACCCTGATACCAAAAGCTGG + Intronic
1027815775 7:82968714-82968736 TTCACCATGTTACCTAGGATTGG + Intronic
1030388077 7:108890642-108890664 GTCACCCAGGTACCAAGTACAGG - Intergenic
1030400326 7:109041155-109041177 TTCATCCTGATACCAAAACCTGG + Intergenic
1031904833 7:127448955-127448977 ATCACCCTGATACCAAAACCTGG + Intergenic
1031912103 7:127528495-127528517 ATCACCCTGATACCAAAATCTGG + Intergenic
1032604992 7:133340507-133340529 ATCACCCTATTACCAAAACCAGG - Intronic
1034112654 7:148553207-148553229 ATCACCCTGATACCAAAACCTGG - Intergenic
1034205870 7:149314674-149314696 ATCACCCTGATACCAAAATCTGG - Intergenic
1034366584 7:150554792-150554814 ATCATCCTGATACCAAAAACTGG + Intergenic
1034708233 7:153166691-153166713 ATCACCCTGATACCAAAATCAGG - Intergenic
1035949078 8:3999253-3999275 GTCAGCCTGTTACCAAGATGGGG + Intronic
1037989292 8:23309179-23309201 TTCACCGTGTTAGCCAGAATGGG + Intronic
1038025523 8:23585602-23585624 TTCACCATGTTAGCCAGGACGGG - Intergenic
1039015348 8:33142004-33142026 ATCACCCTGATACCAAAACCTGG + Intergenic
1039302746 8:36227354-36227376 ATCACCCTGATACAAAAAACTGG + Intergenic
1040406446 8:47108417-47108439 TTCACCGTGTTAGCCAGGACAGG + Intergenic
1041576540 8:59402999-59403021 ATCACCCTGTTACCAAAACTAGG + Intergenic
1042382084 8:68128636-68128658 TCCACCATGTGAACAAGAACAGG - Intronic
1042897124 8:73683123-73683145 ATCACCCTAATACCAAAAACAGG + Intronic
1043298849 8:78701954-78701976 ATCACCCTGATACCAAAACCTGG - Intronic
1043761331 8:84072257-84072279 TTCAGCCTGATACCAAAATCTGG - Intergenic
1044116893 8:88346709-88346731 ATCATCCTGATACCAAAAACTGG - Intergenic
1044955876 8:97479590-97479612 ATCACCCTGATACCAAAACCTGG + Intergenic
1045975341 8:108125055-108125077 ATCACCCTGATACCAAAACCTGG + Intergenic
1046889480 8:119406081-119406103 ATCACCCTGATACCAAAACCTGG + Intergenic
1046895479 8:119467169-119467191 ATCACCCTGATACCAAAACCTGG + Intergenic
1047022450 8:120789896-120789918 ATCACCCTGATACCAAAACCAGG + Intronic
1047147257 8:122216902-122216924 ATCACCCTGATACCAAAACCTGG + Intergenic
1047438866 8:124858687-124858709 TTCACCCTGCTCCCAAGCAATGG + Intergenic
1047633988 8:126739823-126739845 ATCACCCTGATACCAAAACCAGG - Intergenic
1048613552 8:136050018-136050040 TTCACACTGCTATAAAGAACTGG - Intergenic
1049089527 8:140504049-140504071 CTCACCCTGTGACCAACGACTGG + Intergenic
1049362251 8:142217695-142217717 TTCAGCCTGTGACCAAGGTCAGG + Intronic
1049559159 8:143299339-143299361 TACACCCTCTTCCCAACAACCGG - Intergenic
1050661088 9:7883588-7883610 ATCACCCTGATACCAAAACCTGG + Intronic
1050923777 9:11238071-11238093 GTCACCCTGATACCAAAATCTGG - Intergenic
1050983404 9:12049984-12050006 TTCATGCTGTTACAAAGAACAGG + Intergenic
1052424891 9:28291434-28291456 TTATCCCTGTTCCCTAGAACTGG - Intronic
1052564867 9:30136661-30136683 ATCACCCTGATACCAAAACCAGG + Intergenic
1052624613 9:30959172-30959194 TTCACCCTAATACCAAAACCAGG - Intergenic
1052628654 9:31008415-31008437 ATCATCCTGTTACCAAAACCTGG + Intergenic
1052688162 9:31780170-31780192 ATCACCCTGATACCAAAACCTGG + Intergenic
1052753085 9:32512228-32512250 ATCACCCTGATACCAAAACCTGG + Intronic
1053107148 9:35420343-35420365 ATCACCCTGATACCAAAACCAGG + Intergenic
1054753859 9:68937091-68937113 ATCACCCTGATACCAAAATCTGG - Intronic
1054930911 9:70634304-70634326 TTCACCATGTTAACCAGACCAGG + Intronic
1054957391 9:70928355-70928377 ATCACCCTTTTAGCAAGAACTGG - Intronic
1055350314 9:75379718-75379740 TTCATCCAGTCAACAAGAACAGG + Intergenic
1056015298 9:82379514-82379536 ATCACCCTGATACCAAAACCTGG + Intergenic
1056312650 9:85356315-85356337 ATCACCCTAATACCAAGAAGAGG - Intergenic
1056885578 9:90440591-90440613 TTCATCCTGATACCAAAACCTGG - Intergenic
1058030291 9:100188668-100188690 ATCACCCTGATACCAAGACCAGG - Intronic
1058140168 9:101349267-101349289 TCCACCCTGCTCCCCAGAACAGG + Intergenic
1058441529 9:105012660-105012682 ATCACCCTGATACCAAAACCTGG - Intergenic
1060050516 9:120375275-120375297 TTCACCCTGGTACCTAGATGGGG + Intergenic
1060164725 9:121401681-121401703 ATCACCCTGATACCAAAATCTGG + Intergenic
1203424279 Un_GL000195v1:23319-23341 TTCACTCTCATACCCAGAACCGG - Intergenic
1186170725 X:6873465-6873487 TTCGCCCTGAAACCACGAACAGG + Intergenic
1187108955 X:16275760-16275782 ATCACCCTAATACCAAGACCAGG - Intergenic
1188230074 X:27651276-27651298 ATCACCCTGATACCAAAACCTGG - Intronic
1188333438 X:28898967-28898989 TTCACACTGCTATAAAGAACTGG + Intronic
1189564305 X:42224620-42224642 ATCACCCTGATACCAAAACCAGG - Intergenic
1189612415 X:42751505-42751527 TTCACCATGTTAGCCAGGACGGG + Intergenic
1189894253 X:45637376-45637398 ATCACCCTGATACCAAAATCTGG + Intergenic
1190803580 X:53814245-53814267 TTCACCCTGTTGCCAGTAGCTGG + Intergenic
1191177934 X:57525680-57525702 ATCACCCTGATACCAAAAACAGG - Intergenic
1191588617 X:62856442-62856464 ATCACCCTGATGCCAACAACTGG + Intergenic
1191611402 X:63118293-63118315 ATCACCCTGATACCAAAATCAGG + Intergenic
1191738537 X:64413021-64413043 ATCATCCTGATACCAAAAACTGG - Intergenic
1191813873 X:65221855-65221877 ATCACCCTGATACCAAAACCAGG + Intergenic
1192164250 X:68816226-68816248 ATCACCCTGATACCAAAACCAGG + Intergenic
1192196008 X:69028655-69028677 TTCCCCCAGTTACCTAGCACTGG + Intergenic
1192450054 X:71238917-71238939 TTCACTCTGTCACCCAGAATGGG + Intergenic
1192712300 X:73603985-73604007 ATCATCCTGTTACCAAAACCTGG - Intronic
1192724601 X:73735398-73735420 ATCACCCTGATACCAAAATCTGG - Intergenic
1192726506 X:73758845-73758867 ATCACCCTGATACCAAAGACAGG - Intergenic
1193079680 X:77393853-77393875 ATCATCCTGATACCAAGACCTGG + Intergenic
1193385366 X:80864934-80864956 ATCATCCTGATACCAAAAACTGG - Intergenic
1193595103 X:83436025-83436047 TTCATCCTGATACCAAAACCTGG - Intergenic
1194110066 X:89823089-89823111 ATCACCCTGATACCAAAATCTGG - Intergenic
1194183412 X:90740902-90740924 TTCATCCTGATACCAAAACCTGG + Intergenic
1194314944 X:92365964-92365986 ATCATCCTGTTACCAAAACCTGG - Intronic
1194543175 X:95200269-95200291 ATCACCCTATTACCAAAACCAGG - Intergenic
1194882281 X:99268818-99268840 TTCACCCTAATACCAAAACCAGG - Intergenic
1197046097 X:122000515-122000537 ATCATCCTGATACCAAAAACGGG - Intergenic
1197285421 X:124589400-124589422 ATCACCCTGGTACCAAAACCTGG - Intronic
1197363863 X:125539675-125539697 TTCGCCCTGATACCAAAACCAGG + Intergenic
1197698369 X:129575599-129575621 TTCATCCTGTGACCAAGTCCTGG - Intronic
1198008844 X:132529473-132529495 ATCACCCTGATACCAAAACCAGG - Intergenic
1198361540 X:135900470-135900492 ATCACCCTGATACCAAAACCTGG - Intronic
1199063100 X:143382495-143382517 TTCATCCTGTTACTAAAACCTGG - Intergenic
1199065682 X:143414966-143414988 ATTACCCTGTTACCAAAACCAGG - Intergenic
1199343076 X:146705162-146705184 ATCACCCTGCTACCAAAACCTGG - Intergenic
1199496657 X:148459729-148459751 TTAACCATGTAACCAAGAAGAGG - Intergenic
1200312961 X:155098477-155098499 TTTCCTCTGTTACCTAGAACAGG + Intronic
1200462727 Y:3477825-3477847 ATCACCCTGATACCAAAATCTGG - Intergenic
1200530024 Y:4322848-4322870 TTCATCCTGATACCAAAACCTGG + Intergenic
1200878844 Y:8190347-8190369 ATCACCCTGATACCAAAAGCTGG - Intergenic
1201967159 Y:19750649-19750671 ATCACCCTGATACCAAAATCAGG - Intergenic
1202174973 Y:22089710-22089732 TTCATCCTGATACCAAGGCCTGG + Intronic
1202216389 Y:22496673-22496695 TTCATCCTGATACCAAGGCCTGG - Intronic
1202326797 Y:23699391-23699413 TTCATCCTGATACCAAGGCCTGG + Intergenic
1202543972 Y:25970661-25970683 TTCATCCTGATACCAAGGCCTGG - Intergenic