ID: 1070373830

View in Genome Browser
Species Human (GRCh38)
Location 10:75810077-75810099
Sequence CTCATGCTGTTTCGTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 311}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070373830_1070373836 25 Left 1070373830 10:75810077-75810099 CCAGGTGGACGAAACAGCATGAG 0: 1
1: 1
2: 5
3: 48
4: 311
Right 1070373836 10:75810125-75810147 GGCACATTCAGAAATGATGAAGG No data
1070373830_1070373837 26 Left 1070373830 10:75810077-75810099 CCAGGTGGACGAAACAGCATGAG 0: 1
1: 1
2: 5
3: 48
4: 311
Right 1070373837 10:75810126-75810148 GCACATTCAGAAATGATGAAGGG No data
1070373830_1070373832 -7 Left 1070373830 10:75810077-75810099 CCAGGTGGACGAAACAGCATGAG 0: 1
1: 1
2: 5
3: 48
4: 311
Right 1070373832 10:75810093-75810115 GCATGAGCAGAGTCTCTGGCAGG No data
1070373830_1070373838 27 Left 1070373830 10:75810077-75810099 CCAGGTGGACGAAACAGCATGAG 0: 1
1: 1
2: 5
3: 48
4: 311
Right 1070373838 10:75810127-75810149 CACATTCAGAAATGATGAAGGGG No data
1070373830_1070373834 0 Left 1070373830 10:75810077-75810099 CCAGGTGGACGAAACAGCATGAG 0: 1
1: 1
2: 5
3: 48
4: 311
Right 1070373834 10:75810100-75810122 CAGAGTCTCTGGCAGGAAGGAGG No data
1070373830_1070373835 4 Left 1070373830 10:75810077-75810099 CCAGGTGGACGAAACAGCATGAG 0: 1
1: 1
2: 5
3: 48
4: 311
Right 1070373835 10:75810104-75810126 GTCTCTGGCAGGAAGGAGGTTGG No data
1070373830_1070373833 -3 Left 1070373830 10:75810077-75810099 CCAGGTGGACGAAACAGCATGAG 0: 1
1: 1
2: 5
3: 48
4: 311
Right 1070373833 10:75810097-75810119 GAGCAGAGTCTCTGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070373830 Original CRISPR CTCATGCTGTTTCGTCCACC TGG (reversed) Intronic
901123604 1:6913831-6913853 CTCATGCAGTCCCTTCCACCAGG - Intronic
901661376 1:10799889-10799911 CACCTGCTGTTTCTTCCACGTGG + Intergenic
901880292 1:12189891-12189913 CACATGCTGTTGCTTCCTCCTGG - Intronic
902644427 1:17788629-17788651 CTCTTGCTGTTTCTTCCTCCAGG - Intronic
903135715 1:21308125-21308147 CTCATGCTGTTTCCTCCACCTGG + Intronic
903478144 1:23634600-23634622 CACATGCTGTTTCTGCCTCCTGG - Intronic
903569196 1:24291824-24291846 GCCATGCTGTTCCTTCCACCTGG + Intergenic
904212707 1:28896606-28896628 CACATGCTGTTCCTTCCACTAGG - Intronic
904590528 1:31612806-31612828 CTCATGCTGTCCCCTCTACCCGG + Intergenic
905328793 1:37177368-37177390 CTCAGGCTGTTCCCTCCTCCTGG - Intergenic
905528373 1:38656522-38656544 CACATGCTGTTCCTTCCATCCGG - Intergenic
905876537 1:41435376-41435398 CTCATGCTGTTCCTCCCATCTGG - Intergenic
905913307 1:41668593-41668615 CCCATGCTGTTCCTTCTACCTGG + Intronic
906060703 1:42946647-42946669 CACATACTGTTCTGTCCACCTGG - Intronic
906272370 1:44489882-44489904 CTCAAGCTGTTTCTACCACCTGG + Intronic
906718190 1:47985923-47985945 CTCATGTTGTTCCCTCTACCTGG - Intronic
906787777 1:48630861-48630883 CACATGCTGTTTCCTCTGCCTGG + Intronic
906850311 1:49241929-49241951 ATCATGTTATTTCTTCCACCCGG + Intronic
906942244 1:50265488-50265510 CACCTGCTATTTCCTCCACCTGG + Intergenic
907459678 1:54598027-54598049 CTCTTGCTGTTCCCTCTACCAGG + Intronic
907491454 1:54811427-54811449 CTCATGCTGTAACCACCACCGGG - Intronic
907768911 1:57440064-57440086 CTCATACTGTTTCCTCCTCTAGG + Intronic
907831338 1:58067005-58067027 CTCATGCTGTTCTCTTCACCTGG + Intronic
907903416 1:58762389-58762411 CACATGTTATTTCCTCCACCTGG - Intergenic
908230239 1:62097500-62097522 CACATGCTGTTTCATCCTCCAGG - Intronic
908316574 1:62938689-62938711 CTCATGCTTTTTGGTCCCCTTGG - Intergenic
908829082 1:68162248-68162270 CTAAGGCTTTCTCGTCCACCAGG + Intronic
908967059 1:69778092-69778114 TTCATGCTGTTTCCTCTGCCTGG + Intronic
911562813 1:99427301-99427323 CATTTGCTGTTTCTTCCACCTGG + Intergenic
912480848 1:109981193-109981215 CTCAGGCTGTTTCTTCAGCCTGG + Intergenic
913234853 1:116770967-116770989 CTCATGCTGTTGCCTCTACATGG - Intergenic
916871285 1:168917461-168917483 CTTATGCTGGTGCTTCCACCTGG - Intergenic
917474605 1:175358065-175358087 CACATGCTATTTCTTTCACCAGG - Intronic
917977799 1:180251316-180251338 CCCAGGCTGTTTCATCCTCCAGG + Intronic
918261325 1:182799062-182799084 TTCATGGTGGTTCGTGCACCAGG + Intronic
919605321 1:199675052-199675074 CTCATGCTGGTACATTCACCTGG + Intergenic
919954605 1:202400556-202400578 CACATGCTGTTTCCTCTGCCTGG - Intronic
920495601 1:206452969-206452991 CTCACACTGTTCCCTCCACCAGG - Intronic
920544827 1:206807472-206807494 CTCATGCTGTTCCCTCAACCTGG + Intronic
920655331 1:207869936-207869958 CTCATGCTTTTTCCTCCTTCAGG + Intergenic
922169908 1:223145199-223145221 CGCATGCTATTTCTTCTACCTGG + Intergenic
922442939 1:225671527-225671549 CTCATGCTGTTTATCCTACCTGG + Intergenic
923367243 1:233274703-233274725 CTCATGCTGTTTCCTCTGCCTGG - Intronic
924014174 1:239701826-239701848 CTCATGCTATTCCTTCCATCTGG + Intronic
924248738 1:242109650-242109672 CTCATGCTGTCCCTTCCACTGGG + Intronic
1062972138 10:1656304-1656326 CTCATGGCGTCTCCTCCACCAGG + Intronic
1064559397 10:16581202-16581224 CTCATGCTGTTCCCAGCACCAGG - Intergenic
1065490747 10:26279326-26279348 ATCATGCTGTTTCCTCTTCCTGG - Intronic
1065666747 10:28071300-28071322 CTCATCCTTTTCCCTCCACCTGG - Intronic
1065926868 10:30442381-30442403 CACATGCTGTTTTCTCCACCTGG - Intronic
1068013870 10:51489292-51489314 CTCATGCTAATTCCTCTACCTGG - Intronic
1068453896 10:57231074-57231096 GTCATACTGTTTCTTTCACCAGG + Intergenic
1068658114 10:59594988-59595010 CTCATGCTGTCTCTTCTTCCTGG - Intergenic
1069032926 10:63617137-63617159 TGCATGCTGTTTCTTCCACCCGG + Intronic
1069991356 10:72318539-72318561 CTCATGCTGTTCCTTCTGCCCGG - Intergenic
1070341522 10:75502666-75502688 CTCTTGCTGTTTCTTCCAAAGGG + Intronic
1070373830 10:75810077-75810099 CTCATGCTGTTTCGTCCACCTGG - Intronic
1070688481 10:78507518-78507540 CCCATGCTGTTCCTTCCAACTGG + Intergenic
1070745419 10:78930864-78930886 CTCAAGCTGTTCCATCCATCTGG + Intergenic
1071708104 10:88021420-88021442 CTCATGCTATTTTCTCCACAAGG - Intergenic
1071715063 10:88087407-88087429 CACTTACTGTTTCCTCCACCTGG - Intergenic
1074385220 10:113011245-113011267 TTCATGCTGATTCCTCTACCTGG - Intronic
1074605301 10:114957680-114957702 CTCTTGGTGTTTTGTGCACCTGG - Intronic
1074809731 10:117091704-117091726 CTCATGCTGGTCCTTCCACTGGG + Intronic
1074861987 10:117517270-117517292 CACTTGCTGTGTCCTCCACCTGG + Intergenic
1075231684 10:120685311-120685333 CTCCTGCTGTGGCGTCCACAGGG - Intergenic
1075776725 10:124993922-124993944 CTAAGGCTTTCTCGTCCACCAGG + Exonic
1075981824 10:126746880-126746902 CTCAGGCTGGCTCATCCACCGGG - Intergenic
1077556336 11:3227860-3227882 CTCAGGCTGCTATGTCCACCAGG + Exonic
1078406974 11:11078962-11078984 CTCATGCCATTTCTTCCATCCGG - Intergenic
1078431291 11:11290591-11290613 CACATGCTGTTTCCTCTCCCTGG + Intronic
1078449072 11:11426868-11426890 CCCTTGCTGTTTTCTCCACCTGG - Intronic
1078658028 11:13260597-13260619 TTCATGCTGTTTCTTCTACCTGG - Intergenic
1079433636 11:20422415-20422437 CTTATGCTTTTACGTCTACCTGG - Intronic
1079499960 11:21092034-21092056 CTCATCCTGTTCCTTCCATCTGG - Intronic
1079894949 11:26106833-26106855 TGCTTGCTGTTTCTTCCACCAGG - Intergenic
1080132549 11:28814039-28814061 CTCTTGCTGTTTGTTCCTCCTGG + Intergenic
1080819487 11:35791653-35791675 TTCAAGCTGTTCCCTCCACCTGG + Intronic
1081514059 11:43807366-43807388 TACATGCCGTTTCCTCCACCTGG - Intronic
1081607131 11:44534379-44534401 CACTTGCTGTTTTCTCCACCTGG - Intergenic
1081760972 11:45576310-45576332 CTTGTGCTGTGTCCTCCACCTGG - Intergenic
1084167952 11:67385394-67385416 CTCAGACTGTTTCATCCTCCAGG + Intronic
1084453116 11:69251779-69251801 CACAGGCCGTTTCATCCACCCGG + Intergenic
1085103349 11:73820631-73820653 CACATGCTGTTTCCTCTACCTGG + Intronic
1085204746 11:74724598-74724620 AACATGCTGTTTCCTCCACCTGG + Intronic
1085933669 11:81118016-81118038 CTCATGCTGTTTTCTTTACCTGG - Intergenic
1086343885 11:85875477-85875499 CTCATGCTGTTTCCTCTTCCTGG + Intronic
1087057614 11:93948770-93948792 CTACTGCTCTTTCTTCCACCTGG - Intergenic
1089300518 11:117496017-117496039 CTCATGCTCCTCCTTCCACCTGG + Intronic
1091020279 11:132093290-132093312 CACATGCTGTTTCCTCTGCCTGG + Intronic
1091601852 12:1922566-1922588 CTCCTGCTGGTGCCTCCACCCGG + Intergenic
1092454335 12:8628969-8628991 CTCATGCTGTTCCTGTCACCTGG - Intergenic
1093804271 12:23412586-23412608 TTCATGGTGTTTGCTCCACCTGG + Intergenic
1096216365 12:49799846-49799868 CTCATGCTGTTCTTTCCACAGGG + Intronic
1097457724 12:59820597-59820619 CTCATGCTGTTTCTTCTATTTGG - Intergenic
1097894209 12:64808198-64808220 CACATGCTATTTCCTCCGCCTGG + Intronic
1101194212 12:102366169-102366191 CTCTAGCTGTTCCCTCCACCTGG + Intergenic
1101205792 12:102486107-102486129 CTCATGCTGTTCCCTCTGCCTGG - Intergenic
1101343476 12:103863790-103863812 CTCATGCTCTTCCCTCTACCAGG + Intergenic
1101519182 12:105465878-105465900 CTCATGCTGTTTCCTCTACCAGG + Intergenic
1102027553 12:109722140-109722162 CTCATGCTGTTCCCTCCACCCGG - Intronic
1102353255 12:112210560-112210582 CCCATGCTGTTCCTTCCACCTGG + Intronic
1102826600 12:115952282-115952304 CATATGCTGTATCCTCCACCTGG + Intergenic
1102864885 12:116366580-116366602 CGCAAGCTGTTTGGTCCAGCAGG + Intergenic
1103149606 12:118625598-118625620 CTCTTACTGTTTCTCCCACCTGG + Intergenic
1105509622 13:21040454-21040476 CTCTTCCTGGTTCTTCCACCTGG - Intronic
1107193919 13:37624021-37624043 CTCTCGCTGTTTCGTCCAGGCGG - Intergenic
1108810431 13:54217405-54217427 CTCATGCTGCTTCTTTCATCTGG - Intergenic
1110230920 13:73166368-73166390 CTCTTGCTGTTTCCTCTACTTGG + Intergenic
1110293422 13:73834539-73834561 CTCATTCTGTTTCCTACGCCAGG + Intronic
1110896789 13:80762905-80762927 CACTTGCTGTTTCATCCACCTGG - Intergenic
1112925306 13:104666950-104666972 CTGTTGCTGTTTTGTTCACCTGG - Intergenic
1117481788 14:56153084-56153106 TGCATGTTGTTTCTTCCACCTGG + Intronic
1118978497 14:70697748-70697770 CTCCTGCAGTTTCCTCTACCCGG - Intergenic
1119597274 14:75946885-75946907 CTCCCGCTGTTCCCTCCACCTGG - Intronic
1120694336 14:87627667-87627689 CACGTGCTGTTCCCTCCACCTGG + Intergenic
1120913652 14:89690591-89690613 AACATGCTGTTCCTTCCACCTGG - Intergenic
1121434913 14:93912720-93912742 CTCAAGCTGTTTCCTCTACCTGG - Intergenic
1121532164 14:94662596-94662618 CTCAAGTTGTTTCATCCACCAGG + Intergenic
1122563777 14:102636512-102636534 CTCAGGCTATTTCTTCCCCCAGG + Intronic
1123470468 15:20548136-20548158 TTCTTGCTGTTTCTTCCGCCTGG - Intergenic
1123647591 15:22452564-22452586 TTCTTGCTGTTTCTTCCGCCTGG + Intergenic
1124281278 15:28364422-28364444 TTCTTGCTGTTTCTTCCGCCTGG - Intergenic
1124301424 15:28547199-28547221 TTCTTGCTGTTTCTTCCGCCTGG + Intergenic
1125631804 15:41153436-41153458 GTCTTGCTGTCTCGTCCATCAGG + Intergenic
1126680798 15:51200231-51200253 CACTTGCTGTTCCCTCCACCTGG + Intergenic
1127104465 15:55598164-55598186 CTAATGCTGTTTCGTTTTCCTGG + Intergenic
1128734392 15:70044541-70044563 CACATGCTGTTCCTTCCACCTGG + Intergenic
1129163620 15:73762262-73762284 CACATGCTGTTTCCTCTGCCTGG + Intergenic
1129231634 15:74200282-74200304 CTCATGCACTTCCCTCCACCTGG - Intronic
1129660934 15:77552574-77552596 CTGAAGCTGTTACGTCCTCCTGG + Intergenic
1130954079 15:88614601-88614623 ATCAGGCTGTTTCGTAAACCCGG - Intergenic
1131674729 15:94660239-94660261 CTGGTGCTGTTTCCTCCACTTGG - Intergenic
1133732186 16:8587503-8587525 CACATGCTGTTCCCTCCACCTGG - Intronic
1134223550 16:12374291-12374313 CACATGGTGTCTCCTCCACCAGG - Intronic
1134331562 16:13256087-13256109 ACCATGCTGTTTCTACCACCTGG + Intergenic
1134505818 16:14806029-14806051 CACATGCAGTTTCCTCCACCTGG + Intronic
1134574762 16:15322910-15322932 CACATGCAGTTTCCTCCACCTGG - Intergenic
1134727682 16:16433556-16433578 CACACGCAGTTTCCTCCACCTGG + Intergenic
1134939754 16:18278271-18278293 CACATGCAGTTTCCTCCACCTGG - Intergenic
1135065386 16:19305281-19305303 CCCATGCTGTTCCCTCTACCTGG - Intronic
1135395425 16:22128029-22128051 CTCATGCTGTTGCCTCTACCTGG - Intronic
1135932632 16:26751555-26751577 CACATGCTGTTTCCTCTGCCTGG + Intergenic
1136463955 16:30429429-30429451 CTTCTGCAGTTTCCTCCACCTGG + Intronic
1137753060 16:50880727-50880749 CTCAGGCTGTTTCCAACACCTGG - Intergenic
1137915866 16:52429309-52429331 ATCTTGCTGTTTCCTACACCTGG - Intergenic
1138199802 16:55080244-55080266 CCCATGCCATTTCCTCCACCAGG - Intergenic
1138262891 16:55638128-55638150 CTCCTGTTGTTTTGGCCACCTGG - Intergenic
1138483155 16:57317427-57317449 CTCATGCTGTTCCCTCCTACAGG - Intergenic
1138497704 16:57418263-57418285 CTTATGTTGTTTCTTTCACCTGG + Intergenic
1139715530 16:68810204-68810226 CTCACGCTGTGTCATCCAACGGG + Exonic
1141901337 16:86993043-86993065 CTCATGCTGTTCCTTCCAGCTGG - Intergenic
1143301339 17:5912700-5912722 CTCATGCTGTTCCATCTGCCTGG - Intronic
1143571631 17:7762684-7762706 CTCATGCTATTTCCTCCACATGG - Intronic
1144274952 17:13657378-13657400 CACTTGCTGTTTCATCTACCTGG - Intergenic
1144771541 17:17762299-17762321 CACATGCTGTTCCCTCCGCCTGG - Intronic
1144958570 17:19032194-19032216 CTCATGCTGTTTCCTGTGCCTGG + Intronic
1144965839 17:19076862-19076884 CACATGCTGTTCTCTCCACCTGG - Intergenic
1144982129 17:19175320-19175342 CACATGCTGTTCTCTCCACCTGG + Intergenic
1144986094 17:19202919-19202941 CACATGCTGTTCTCTCCACCTGG - Intergenic
1145240012 17:21235683-21235705 CTCATGTTGGTTAGTCCACCTGG + Intergenic
1145262302 17:21361583-21361605 CACATGCTGTTTCCTCTACCTGG + Intergenic
1146095083 17:29922128-29922150 CACATGCTGTTTCCTTTACCTGG - Intronic
1146438573 17:32874022-32874044 CTCATGCTGCTTAATCCACCTGG + Intronic
1146467365 17:33096821-33096843 CACTTGCTGTTCCCTCCACCTGG - Intronic
1146577348 17:34006257-34006279 CACATGCTGATTCTTCCTCCTGG - Intronic
1150018817 17:61589574-61589596 CACATGCTGTTCCCTCTACCTGG - Intergenic
1150492949 17:65586941-65586963 CTCATGCTGTTCCATCTTCCAGG - Intronic
1150502454 17:65664243-65664265 CTCATGGTTTTTCCTTCACCTGG - Intronic
1150922672 17:69500056-69500078 CTCATACTGTTCCTTCTACCTGG - Intronic
1151151747 17:72094148-72094170 CACATGCTGTTCCCTCTACCTGG + Intergenic
1203161503 17_GL000205v2_random:56600-56622 CTCAGGCTTTCTCGTCCACCAGG + Intergenic
1153944535 18:10007530-10007552 TTCATGCTGTCTTATCCACCAGG + Intergenic
1154277140 18:12971865-12971887 CACATGCAGTTTTCTCCACCAGG - Intronic
1155224092 18:23713286-23713308 CTCGTGCTGGTTCCTCTACCTGG + Intronic
1158782117 18:60663863-60663885 CTAAGGCTTTCTCGTCCACCAGG - Intergenic
1159897162 18:74008287-74008309 CACATGCTGTTCCACCCACCTGG - Intergenic
1160227085 18:77019843-77019865 CTCCTGCTGCTTCCGCCACCGGG - Intronic
1161470029 19:4452600-4452622 CCCATGCTGTCCCTTCCACCTGG + Intronic
1161644861 19:5447048-5447070 CATATGCTGTTCCTTCCACCTGG + Intergenic
1163105803 19:15122546-15122568 CACATGCTGTTCCTTCTACCTGG + Intronic
1163567053 19:18058188-18058210 CTCAAGCCGTTCCCTCCACCAGG - Intergenic
1163702517 19:18793280-18793302 CCTATGCTGTTTCCTCTACCTGG - Intergenic
1163785188 19:19271300-19271322 CTCAGGCTGTTTCTTCCTTCTGG + Intronic
1165119401 19:33549417-33549439 CTCCTCCTGTCTCATCCACCAGG + Intergenic
1166701663 19:44885847-44885869 CACATGCTGTTCCCTCTACCTGG - Intronic
1167338765 19:48902767-48902789 CTCATGCTGTTCCCTCTGCCTGG - Intronic
1168486626 19:56768079-56768101 CTCATGCTGTTTCCTCTGCCCGG + Intergenic
1168580881 19:57554812-57554834 CACACGCTGGTTCCTCCACCTGG + Intronic
926683212 2:15679691-15679713 CTCATACTGTTTCCTCTGCCTGG + Intergenic
927699039 2:25256341-25256363 CTCATGCTGTTCCTTCTTCCTGG + Intronic
929073539 2:38058356-38058378 CTCATGCTGCTTCTTCCTGCAGG - Intronic
932172521 2:69570253-69570275 CACATGCTGTTTCCTCTGCCTGG + Intronic
932570507 2:72935989-72936011 CTCATGCTGTTCTTCCCACCTGG + Intronic
932571994 2:72943088-72943110 CTCCCGCTGTTTTGTCCTCCAGG + Exonic
936507227 2:113117307-113117329 CCCTTGCTGTTCCCTCCACCTGG + Intronic
936527802 2:113253584-113253606 CACATGCTGTTCCCTCCTCCTGG + Intronic
937082704 2:119151742-119151764 GTCATGCTCTTTCCTCTACCTGG - Intergenic
938122036 2:128640894-128640916 CCCATGCTGTTTCATTCACTAGG - Intergenic
943900764 2:193432721-193432743 CTCATGCTATTTCCTCCAAGGGG - Intergenic
944657449 2:201890320-201890342 CTCATGCTGATCCCTCAACCGGG + Intronic
946175141 2:217917966-217917988 CTCATTCTGTTTCAGCCGCCCGG - Intronic
946239783 2:218346454-218346476 CTCATGCTGTTTCTTCCGACTGG + Exonic
947716824 2:232344737-232344759 CGCATCCTGTTACCTCCACCAGG - Intergenic
947937414 2:234020044-234020066 CTGCTGCTGCTTGGTCCACCTGG + Intergenic
948076398 2:235168293-235168315 CTCATGCTGTTTCCTCTGCTGGG - Intergenic
948291056 2:236825105-236825127 CTCATGCTGTCCGGGCCACCTGG + Intergenic
948547209 2:238741440-238741462 CACATGCTGCTTGGTCTACCTGG + Intergenic
1168747849 20:259506-259528 ATCATGCAGATTCGTCCACAGGG + Exonic
1168811249 20:706185-706207 CACTTGCTGTTCCCTCCACCTGG - Intergenic
1168836550 20:881503-881525 CATATGCTGTTTCTTCCGCCTGG - Intronic
1168978256 20:1983926-1983948 CACATGCTGTTCCCTCCGCCTGG + Intronic
1169118468 20:3082230-3082252 CTCTTGCTGTCTTGTCCTCCAGG + Intergenic
1170223127 20:13962483-13962505 CTCATGCAGTTTCATGCAGCTGG - Intronic
1170675044 20:18471235-18471257 ATCATGCTGTTTCGTGCCACAGG + Intronic
1170778653 20:19403721-19403743 CGCATGCTGTTCCCTCTACCTGG - Intronic
1171154506 20:22859783-22859805 CACATGCTGTTTCTTCTGCCTGG + Intergenic
1171425115 20:25044093-25044115 CTCAGGCTGCTTCCTGCACCTGG + Intronic
1172028725 20:31967419-31967441 CACTTGCTCTTTCCTCCACCCGG + Intergenic
1172816345 20:37690152-37690174 CTCATGCTGTTCCCTCTGCCTGG + Intergenic
1173041171 20:39464354-39464376 CTCTTGCTGTCCCCTCCACCAGG - Intergenic
1173503358 20:43569010-43569032 CTCATGCTATTTCCTCTTCCTGG - Intronic
1173598989 20:44279628-44279650 CCCAGGATGTTTCGTCCACCAGG + Exonic
1173861604 20:46287504-46287526 CCCAGGCTGTTCCCTCCACCTGG - Intronic
1174051560 20:47770915-47770937 CCCATGGTGTTCCTTCCACCAGG + Intronic
1174288107 20:49486230-49486252 CACTTGCTGTTTCCTCCACCTGG - Intergenic
1175366896 20:58461782-58461804 CTCCTGCTGTCTCTTCCACCTGG + Intronic
1176038142 20:63050245-63050267 CCCATGGTGTTTCCCCCACCTGG + Intergenic
1176341235 21:5697753-5697775 CTAAGGCTCTCTCGTCCACCAGG - Intergenic
1176473489 21:7129906-7129928 CTAAGGCTCTCTCGTCCACCAGG - Intergenic
1176503592 21:7626703-7626725 CTAAGGCTCTCTCGTCCACCAGG + Intergenic
1179834883 21:44024269-44024291 CTCATGCTGCTTCAGTCACCTGG + Intronic
1182104243 22:27677917-27677939 TTCATGCCGTTTCGTCCCCAGGG + Intergenic
1183315339 22:37133906-37133928 CACATGCTGTTTCCTCTGCCTGG + Intronic
1183647473 22:39134813-39134835 CTCATGCTGTTCCTCCCACCCGG + Intronic
1184262450 22:43326809-43326831 CTCATGCTGTTCCCTCTGCCTGG + Intronic
1184398912 22:44262221-44262243 CTGAGGCTGTTCCGTCCGCCTGG - Intronic
1184656855 22:45946273-45946295 CAGATGCTGTTCCGTCCACCTGG + Intronic
1185280203 22:49966679-49966701 CTGAGGCTGTTTCCCCCACCTGG + Intergenic
1203240499 22_KI270733v1_random:12217-12239 CTAAGGCTCTCTCGTCCACCAGG - Intergenic
950635200 3:14309160-14309182 CTCTTGCTGTTCCTCCCACCTGG - Intergenic
952500762 3:33959691-33959713 CACATGCTGTTTCCTACACCTGG - Intergenic
953091617 3:39732673-39732695 TTCATGCTGTTTCCTCTGCCTGG - Intergenic
953381077 3:42473365-42473387 TTCATCCTGTTTCCTCCTCCAGG + Intergenic
953879539 3:46684482-46684504 CTCATACTGTTCCTTCTACCTGG + Intronic
954422485 3:50426002-50426024 CTCATGCTCTGCCCTCCACCCGG + Intronic
955126418 3:56116659-56116681 CTCATGCTGTGCCCTCAACCTGG + Intronic
955906959 3:63817127-63817149 CACATGCTGTTTCATCTGCCTGG + Intergenic
956837044 3:73103971-73103993 CACAGGCTCTTTCCTCCACCGGG + Intergenic
957137419 3:76307169-76307191 CTCATGCTATTTCCTCAGCCTGG + Intronic
959892437 3:111571123-111571145 CACATGCTGTTCCCTCTACCTGG + Intronic
960631008 3:119730309-119730331 CTCCTGCAGTTTAGACCACCGGG - Exonic
960739969 3:120822336-120822358 CACTTGCTGCTTCCTCCACCAGG - Intergenic
961653871 3:128430872-128430894 CTCTTGCTGTTCCCTCCGCCTGG - Intergenic
961984132 3:131114532-131114554 CTCTTGCTTTTCCCTCCACCAGG - Intronic
963998822 3:151743048-151743070 CTCATGCTCTTTCGTTAACAAGG + Intronic
965420345 3:168450034-168450056 CTCCTGCAGATTCCTCCACCTGG + Intergenic
967172146 3:186830067-186830089 CTCATGCTATTCCCTCCGCCAGG - Intergenic
967317192 3:188160520-188160542 CTTATGCTGTTTTCTCTACCTGG + Intronic
967820600 3:193835674-193835696 CTCAAGCTGTTGTCTCCACCTGG + Intergenic
968884187 4:3318504-3318526 CTCGTGCTGTTTCCTCCATGGGG + Intronic
969300072 4:6292375-6292397 CTCATGCTGTTCCCTCTGCCCGG - Intronic
971062752 4:22990973-22990995 CTCATTCTAGTTCATCCACCTGG - Intergenic
972323232 4:37991902-37991924 CTCATGCAGTTTCTTCCACCTGG - Intronic
972663581 4:41142311-41142333 TCCATGCTGTTTCATTCACCTGG + Intronic
973254014 4:48090886-48090908 CACATGCTGTTCCATCTACCTGG - Intronic
975624560 4:76331632-76331654 TCCATTCTGTTTCCTCCACCTGG - Intronic
977905579 4:102474711-102474733 CACATGCTGTTCTGTCCATCTGG - Intergenic
978286152 4:107079467-107079489 TTCAGGCTGTTTCATCCAACTGG + Intronic
980904983 4:138939485-138939507 CTCATGCTGTTTCCTTTACCTGG - Intergenic
982066747 4:151661062-151661084 TTCATGCTTGTTCCTCCACCTGG - Intronic
982905001 4:161056814-161056836 CTCCAACTGTTTCGTTCACCTGG + Intergenic
984467314 4:180116957-180116979 CATATGCTGATTCTTCCACCTGG + Intergenic
986020431 5:3796493-3796515 CTCATGCTGTTTCTTCTGTCTGG + Intergenic
988995416 5:36710190-36710212 CACATGCTGCTTCTTTCACCAGG + Intergenic
992207860 5:74448541-74448563 CTCGTGCTGTTTCTTTCACTTGG - Intergenic
993721578 5:91326237-91326259 CACATGCTGTTCCGTCTGCCTGG + Intergenic
994336825 5:98576744-98576766 CTAAGGCTTTCTCGTCCACCAGG - Intergenic
994674525 5:102804066-102804088 CTCTTACTGTTTCTTCCTCCTGG - Intronic
995163679 5:109011948-109011970 CTCATGCTGTTTTCTTTACCTGG + Intronic
995768209 5:115641368-115641390 GGCATGCTGTTTCTTCCACAGGG - Intergenic
996640703 5:125749063-125749085 ATCATTCTGTCTTGTCCACCAGG + Intergenic
996857087 5:128020426-128020448 CTCAAGCTGTGGCCTCCACCAGG + Intergenic
998547285 5:143040735-143040757 CTCCAGCTGTTTCCTCTACCTGG - Intronic
999283365 5:150379510-150379532 CTCATCCTGTTTCTCCCTCCAGG + Exonic
999694596 5:154177994-154178016 CTCATGCTGTTTCCTCCTCCAGG - Intronic
1000051986 5:157571376-157571398 CACTTGCTGTTTCCTCTACCTGG - Intronic
1000341382 5:160279685-160279707 CACATGCTGTTCCCTCTACCTGG - Intronic
1000483781 5:161813133-161813155 CCCATGCTGTTCCTTCCACCTGG + Intergenic
1004320134 6:14625730-14625752 TTCATGCTGTTTTCTACACCTGG - Intergenic
1004409144 6:15364206-15364228 GTGCTGCTGTTTCTTCCACCAGG - Intronic
1004685493 6:17939628-17939650 CTCATGCTGTTTTATCAACAAGG - Intronic
1004861934 6:19813216-19813238 CTCAGGCTGTTACTTCTACCTGG + Intergenic
1005357452 6:24998067-24998089 CTCATGCTGTTCTCTGCACCTGG - Intronic
1005695411 6:28347304-28347326 CCCTTGCTGTTTCCTCTACCGGG + Intronic
1006597588 6:35204702-35204724 CTCATGTTGTTCCTGCCACCTGG + Intergenic
1007632562 6:43280890-43280912 CCCAGGCAGTTTCCTCCACCTGG - Intronic
1008697034 6:54050942-54050964 CTCATGCTGTTTACTGCATCTGG + Intronic
1010369689 6:75092970-75092992 TTCATGCTGTTTCCTCTGCCTGG + Intronic
1010701378 6:79052285-79052307 CACATGCTGTTTCCTCAACCTGG - Intronic
1012982656 6:105846549-105846571 CTCATGCAGCCTCGACCACCTGG + Intergenic
1013098696 6:106969367-106969389 CACATGCTGTTCCTTCTACCAGG + Intergenic
1013464587 6:110406685-110406707 TGTATGCTGTTTCCTCCACCTGG + Intronic
1014163756 6:118200475-118200497 CTCCTGCTGTTTCAGCAACCAGG - Intronic
1015723940 6:136279218-136279240 CTCATTCTTTTTCCCCCACCAGG - Intronic
1015846922 6:137530595-137530617 CACCTGCTGTTTCCTCCACCAGG + Intergenic
1017662616 6:156688449-156688471 CTCATGTTGTTCCCTCAACCTGG - Intergenic
1019457326 7:1137212-1137234 CACCTGCTGTTTCCTCGACCTGG + Intronic
1019559995 7:1651160-1651182 CTCATGCTGGTGCCTCCGCCTGG - Intergenic
1019788646 7:2996143-2996165 CCCATGCTGTTCCATGCACCGGG + Intronic
1020435424 7:8157422-8157444 CTCATGCTGCTCCCACCACCTGG + Intronic
1020722362 7:11763240-11763262 CAAATGCTGCTTCCTCCACCTGG + Intronic
1021360853 7:19709957-19709979 CTCACGCTGTTCCTTCCACCAGG + Intergenic
1022026058 7:26448897-26448919 CACAGACTGTTTCCTCCACCCGG - Intergenic
1022517612 7:30986058-30986080 CACGTGCTGTTTCCTCTACCTGG - Intronic
1024048085 7:45598999-45599021 CTGCTGCTGTTTCATGCACCAGG + Intronic
1029607475 7:101607894-101607916 CTCATGCTGCTCCCTCTACCTGG - Intergenic
1030179720 7:106693347-106693369 CACTTGCTGTTTCTTGCACCTGG - Intergenic
1031451275 7:121923144-121923166 CTCATGCCTTTTCTTCTACCTGG + Intronic
1031915958 7:127563485-127563507 CTCTTGCTGTATCTTCTACCTGG - Intergenic
1032415515 7:131732618-131732640 CTCTTGCTGTTCCCTCCACCTGG + Intergenic
1032429156 7:131846934-131846956 CTCATGCTGTTCCCTCTGCCTGG - Intergenic
1034860007 7:154586731-154586753 CTCGTGCTGTTTCCTCCACCTGG + Intronic
1036977233 8:13427312-13427334 CTCATTCTGTTCTGTCCTCCTGG + Intronic
1038941512 8:32310896-32310918 CTCATGCTGTTCCCTCTACCTGG + Intronic
1039799942 8:40945253-40945275 CTCCTGCTGTTTCTGCAACCTGG + Intergenic
1041491304 8:58436750-58436772 CTCTTGCTGTGTCATACACCAGG + Intronic
1042951360 8:74203697-74203719 CTCATGCTATTTCCTCTGCCTGG + Intergenic
1044061463 8:87641457-87641479 CTCACGCTGTTTCTCCCTCCAGG - Intergenic
1045526946 8:102949059-102949081 CTCATGCTTTTCCTTCTACCTGG + Intronic
1045758025 8:105568945-105568967 GTCATGCTGTTTTATCCTCCTGG + Intronic
1047523306 8:125612296-125612318 CTCATGCTGCTTCCTCCATCTGG - Intergenic
1047799883 8:128297769-128297791 CTCTGGGTGTTTCCTCCACCTGG + Intergenic
1048397458 8:134027819-134027841 CTCATGCTGTGTGCTACACCTGG + Intergenic
1049240078 8:141533220-141533242 CCCTTGCTGTTTTCTCCACCAGG + Intergenic
1049766405 8:144357283-144357305 TTCCTGCTGTTTCCTCCAGCAGG - Intronic
1051914892 9:22197064-22197086 CTAATGCAATTTCCTCCACCTGG - Intergenic
1053272720 9:36761347-36761369 CTGATGCTGTTCCTTCTACCTGG - Intergenic
1053364272 9:37511652-37511674 CTCATGCTCTTTCCTCCTCCCGG - Exonic
1054703223 9:68435030-68435052 CTCAAGCTGTTTCCTCTACTAGG + Intronic
1054720276 9:68596510-68596532 CTCATGCTGTGACCCCCACCTGG + Intergenic
1056090959 9:83205468-83205490 CTCATGCTGTTTCTACCAACTGG + Intergenic
1057745547 9:97748186-97748208 CTCATGCTGTTTCCTCTGCCTGG + Intergenic
1058122760 9:101156789-101156811 CTCAAGCTATTTCCTCCATCTGG - Intronic
1059426922 9:114227047-114227069 CTCAAGCTGTTTCCTATACCCGG - Intronic
1059524835 9:114981034-114981056 CAAATGCTGTTTTGTCCACATGG - Intergenic
1060675000 9:125505693-125505715 CACAGGCTATTTCTTCCACCTGG - Intronic
1061109641 9:128559758-128559780 CTCTTGCTTTTTCGTCGCCCAGG + Intronic
1061296283 9:129678588-129678610 CGTCTGCTGTTTCCTCCACCCGG - Intronic
1061394148 9:130334134-130334156 CACATGCTGTTCCTTCTACCTGG - Intronic
1203421832 Un_GL000195v1:240-262 CTAAGGCTCTCTCGTCCACCAGG + Intergenic
1187110981 X:16300068-16300090 CTGATGCTCTTTCCCCCACCCGG - Intergenic
1187288812 X:17932306-17932328 CTCACCCTGTTTCTCCCACCCGG + Intergenic
1187726963 X:22213283-22213305 CTCACACTGTTTCTTCTACCTGG - Intronic
1188548329 X:31334916-31334938 CTTTTACTGTTTCCTCCACCTGG + Intronic
1189048909 X:37622741-37622763 CTAATGCTGTTTTCCCCACCTGG + Intronic
1189209136 X:39268140-39268162 CTCATGCTGTTCCTTCTACCTGG + Intergenic
1189299601 X:39942925-39942947 CACATGGTGTCTCTTCCACCTGG - Intergenic
1189548965 X:42073289-42073311 CTTATGTTGTTCCTTCCACCTGG + Intergenic
1190337996 X:49274463-49274485 CCCCTGCTGTTTCCTTCACCAGG + Intronic
1193565760 X:83075086-83075108 CACATGCTGTTTCCTCTGCCTGG - Intergenic
1195062317 X:101208226-101208248 CTCATGCTGTTTGCTCAGCCTGG + Intergenic
1195728476 X:107941076-107941098 CACATGCTGTTTCCTCTACCTGG - Intergenic
1198517182 X:137421281-137421303 CACTTGCTGTTTCTTCTACCTGG + Intergenic
1199854446 X:151749087-151749109 CTCATGCTGTTCCCTCTGCCTGG + Intergenic
1199860653 X:151798088-151798110 CTCGTGCTGTTAGGTCAACCTGG + Intergenic