ID: 1070373833

View in Genome Browser
Species Human (GRCh38)
Location 10:75810097-75810119
Sequence GAGCAGAGTCTCTGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070373830_1070373833 -3 Left 1070373830 10:75810077-75810099 CCAGGTGGACGAAACAGCATGAG 0: 1
1: 1
2: 5
3: 48
4: 311
Right 1070373833 10:75810097-75810119 GAGCAGAGTCTCTGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070373833 Original CRISPR GAGCAGAGTCTCTGGCAGGA AGG Intronic
No off target data available for this crispr