ID: 1070375183

View in Genome Browser
Species Human (GRCh38)
Location 10:75823594-75823616
Sequence TAGTGGGATTGCAAGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 1, 2: 35, 3: 117, 4: 455}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070375183_1070375190 27 Left 1070375183 10:75823594-75823616 CCTTTGATCTTGCAATCCCACTA 0: 1
1: 1
2: 35
3: 117
4: 455
Right 1070375190 10:75823644-75823666 TCAACCTAAGTATCCATCAATGG 0: 26
1: 350
2: 1123
3: 2631
4: 3851

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070375183 Original CRISPR TAGTGGGATTGCAAGATCAA AGG (reversed) Intronic
902967495 1:20018695-20018717 TAGTGGGATTGCTAGACCATTGG + Intergenic
903013454 1:20346532-20346554 AAGTAGGATTGCAATGTCAAGGG + Intronic
903571986 1:24312721-24312743 GAGTGAAATTGCTAGATCAAAGG + Intergenic
904096592 1:27983309-27983331 AAGTGGAATTGCATGATCATAGG + Intronic
904513971 1:31038766-31038788 AAGTGGAATTACCAGATCAAAGG - Intronic
905103724 1:35548864-35548886 CAATGGGAATGCAAGAGCAAAGG - Intronic
906189661 1:43888899-43888921 AAGTGGGTTTGCTGGATCAAAGG - Intronic
906867335 1:49436599-49436621 GATTGGGAATGCAAGAACAAAGG + Intronic
907338945 1:53719820-53719842 CAGTGGGATTGCTGGATCATAGG - Intronic
908434490 1:64091889-64091911 TAGTTGGATGGACAGATCAAGGG + Intronic
908563990 1:65335619-65335641 TAGTGGAATTGTAAGTGCAAAGG + Intronic
909420195 1:75455981-75456003 TAATGAGATTGCTGGATCAAAGG - Intronic
910561338 1:88595371-88595393 TAGTAGAATTTCAAGATCAATGG + Intergenic
910697623 1:90037315-90037337 AGGTGGGATTGCTAGATTAAGGG - Intergenic
911471191 1:98320063-98320085 TAGTAGGATTGCAGGATTCAAGG + Intergenic
911546157 1:99219563-99219585 AAGTGGGATTGCTAGATCATAGG + Intergenic
911742693 1:101404335-101404357 TAATGGGATTGCTGGATCTAAGG + Intergenic
912061707 1:105680728-105680750 TAGTGGGATTGCCAGATCCTAGG - Intergenic
912644491 1:111379344-111379366 GAGTGGGATTACTGGATCAAAGG + Intergenic
912987708 1:114451306-114451328 TAATGGGATTGAATGATCTAAGG - Intronic
913101220 1:115568646-115568668 TAGTGGAATTGCTGGATCATAGG - Intergenic
913426774 1:118739905-118739927 GAGTCGGATTGCTAGGTCAAAGG - Intergenic
913548267 1:119891760-119891782 AAGTGGAATTGCTAGATCATGGG - Intergenic
914330243 1:146662548-146662570 TAGTGGGATTGCTGGATCATAGG - Intergenic
914765971 1:150638195-150638217 GAGAGGGATTGCAAGGTCATGGG - Intergenic
916441931 1:164835343-164835365 AAATGGAATTGCTAGATCAAAGG + Intronic
917295702 1:173516833-173516855 TAATGGGATTGCTGGGTCAATGG + Intronic
917557434 1:176104761-176104783 AAGTGGGATTGCTGGGTCAAAGG - Intronic
918942314 1:191016532-191016554 TAGTGGGATTGCTGATTCAAAGG + Intergenic
919150729 1:193694714-193694736 GAGTGGGATTGTTAGATCATAGG - Intergenic
919236627 1:194853711-194853733 TAGTGAGATTGCTGGTTCAAAGG + Intergenic
919245537 1:194978175-194978197 TAATGGGATTGCTGGGTCAAAGG + Intergenic
919543952 1:198888664-198888686 CTTTGGCATTGCAAGATCAAAGG - Intergenic
920148010 1:203879489-203879511 AAGTGGAATTGCTAAATCAAAGG + Intergenic
920429857 1:205911525-205911547 CAGTGGGTTTGGAAGATGAAAGG + Intergenic
920536538 1:206740917-206740939 TAGTGGAATGGCAAGATCTAAGG + Intergenic
920604176 1:207364046-207364068 TAGGGGGATTGCAATAACAAGGG - Intergenic
921113357 1:212061524-212061546 TAATGAGACTGCTAGATCAATGG - Intronic
923077050 1:230619101-230619123 TGGTTGGATTCCAAGAGCAAGGG - Intergenic
923085386 1:230699315-230699337 TAATGGGATTGCTGGGTCAATGG + Intergenic
923695871 1:236250776-236250798 TAGTGGGACTGCAGGTTCAAAGG - Intronic
923957125 1:239034754-239034776 TAGTGTGATTCTAAGTTCAAAGG - Intergenic
924647336 1:245890693-245890715 CAGTGAGATTGCTGGATCAATGG - Intronic
1064451224 10:15443657-15443679 TACTGCGATTGCTGGATCAAAGG + Intergenic
1064510761 10:16088284-16088306 AAGTGGGATTGCTGGATCACAGG - Intergenic
1065135588 10:22665923-22665945 AAGTGGGACTGTGAGATCAAAGG + Intronic
1065381920 10:25099461-25099483 TGGTGGGATTGCTGGATCAAAGG + Intergenic
1065428098 10:25626728-25626750 TCAGGGGATTGCTAGATCAAAGG - Intergenic
1065703948 10:28453254-28453276 AAGTGGGATTGCTGGATCATAGG + Intergenic
1065996865 10:31067620-31067642 TAATGGGATTGCTAGGTAAACGG - Intergenic
1066104946 10:32148192-32148214 TAGTGGGATTGTTGGAGCAATGG + Intergenic
1066170787 10:32842566-32842588 AAGTGGGATTGCTGGATCAAAGG - Intronic
1066426277 10:35310430-35310452 CAGTGGGCTTGCTAGATCAAAGG + Intronic
1067916452 10:50404675-50404697 GAGTGGGATTGCTACATCAGTGG - Intronic
1068043037 10:51850954-51850976 AAGTAGGATTGCTAGATCAAAGG - Intronic
1068114222 10:52719334-52719356 TAATGGGATTGCTGGGTCAAAGG - Intergenic
1068593660 10:58877343-58877365 TAGTGGGATTGATAGATCTTAGG + Intergenic
1068861035 10:61848470-61848492 AATTGGGATTACAAGGTCAAAGG - Intergenic
1068884990 10:62088867-62088889 TAATGGGATTGCAAGTTGCATGG + Intronic
1069713073 10:70502479-70502501 TAGAAGGATTGCAGGGTCAAAGG + Intronic
1070054007 10:72916696-72916718 TAATGGCATTGCTAGGTCAAAGG + Intronic
1070375183 10:75823594-75823616 TAGTGGGATTGCAAGATCAAAGG - Intronic
1070900469 10:80023594-80023616 TAGTGGGATTGCTGGGTGAATGG - Intergenic
1071686772 10:87766219-87766241 GAGCGGAATTGCTAGATCAAAGG - Intronic
1072300313 10:94054481-94054503 TAGTTGGAGGGCAAGATCTAAGG + Intronic
1072367025 10:94722025-94722047 TAGTGGGATTGCTGGATCAAAGG + Intronic
1072928473 10:99638910-99638932 TAGTGGGATTGCTGGATCAAGGG - Intergenic
1072952875 10:99863259-99863281 TAGTGGAATTGCTAGATATATGG + Intergenic
1073198282 10:101713414-101713436 TAGTGGGGTTGCTAGATATATGG + Intergenic
1073913144 10:108370591-108370613 TAATGGGATTGCTGGGTCAAAGG - Intergenic
1074647207 10:115471364-115471386 TGGTGGGATTGCTGGATCATTGG + Intronic
1074740063 10:116477921-116477943 TATTGTTATTGCAAGAACAAAGG - Exonic
1075324700 10:121521786-121521808 AAGTGGGATTGCAGGATCTTAGG - Intronic
1076090938 10:127684878-127684900 TACTAGGAGTGCAAGATCAGAGG + Intergenic
1076148963 10:128147746-128147768 TAGTGGAATTGCTGGATCATAGG - Intergenic
1077428999 11:2506005-2506027 CAGTGGGATTGCTGGATCACAGG - Intronic
1078588408 11:12615764-12615786 GAGTGGGATTACTGGATCAAAGG - Intergenic
1078707094 11:13754989-13755011 TAGTGGGATTGCTGGACAAATGG - Intergenic
1080055184 11:27899663-27899685 TAATGGGATTGCTGGGTCAATGG - Intergenic
1080327592 11:31095305-31095327 TAATGGGATTGCTGGGTCAATGG + Intronic
1080589645 11:33710652-33710674 AAGTGGAATTGCTGGATCAAAGG - Intronic
1082126776 11:48441431-48441453 TAGTGGGATTGCTGGATCAAAGG + Intergenic
1082250243 11:49970896-49970918 TATTGGGATTGCTGTATCAAAGG - Intergenic
1082560348 11:54612397-54612419 TAGTGGGATTGCTGGATCAAAGG + Intergenic
1083135560 11:60672381-60672403 TAGTGGGATAACAAATTCAAAGG - Intergenic
1083346270 11:61995213-61995235 ATGTGGGATTGCAGGATCAAAGG + Intergenic
1083533481 11:63447127-63447149 TTGTGGGTTAGCAAGTTCAAGGG + Intergenic
1083628935 11:64085977-64085999 TAGTGGGCTTGCAGCCTCAAAGG + Intronic
1084983975 11:72851244-72851266 AAGCGGAATTGCTAGATCAATGG - Intronic
1085090804 11:73711642-73711664 AAGTGGGATTTCCAGGTCAAAGG + Intronic
1087504694 11:99004322-99004344 TAATGGGATTGCTGGGTCAATGG + Intergenic
1087607144 11:100390716-100390738 TAATGGAATTGCTGGATCAAAGG - Intergenic
1087980059 11:104601054-104601076 TCGTGGGATTGCTGGATCAATGG - Intergenic
1088059048 11:105623231-105623253 TAGTGGGATTGCTGGATCAAAGG + Intronic
1088703975 11:112444248-112444270 TAGTGGGAATGCAAGCACTATGG - Intergenic
1089057111 11:115594591-115594613 TAGTGGAACTGCTGGATCAATGG + Intergenic
1089957199 11:122582416-122582438 TAGTGGGATTGCTGGATCAAAGG + Intergenic
1090181182 11:124701264-124701286 TAGTGGGATTGCTGGGTGAATGG + Intergenic
1090249496 11:125241494-125241516 TATTGGGATTGAAAGAAGAATGG - Intronic
1090345913 11:126070417-126070439 GACTGGGACTGCAGGATCAAAGG - Intergenic
1091113067 11:132988721-132988743 TAGTGGGTTTGTTTGATCAAAGG + Intronic
1091332524 11:134741403-134741425 TAGTGGGATTGCTGGATCTAAGG + Intergenic
1091676881 12:2497909-2497931 TAGTGGGATGGCAAGATGAAGGG - Intronic
1092438158 12:8470404-8470426 TAGTGGGATTGCTGGATCAAAGG - Intronic
1093394283 12:18661761-18661783 TAATGGGATTGCTGGGTCAATGG - Intergenic
1093663348 12:21783132-21783154 TAATGGGATTGCTGGGTCAATGG + Intergenic
1093770535 12:23012404-23012426 TAATGGGATTGCTGGGTCAATGG + Intergenic
1093868370 12:24256437-24256459 AAGTGGGATTTCCATATCAAAGG - Intergenic
1094345072 12:29459105-29459127 GAGTGGGATTGCTAGATCAATGG - Intronic
1095682689 12:44997266-44997288 TAATGGGATTGCTGGGTCAAAGG + Intergenic
1095711109 12:45289114-45289136 TAGTAGAATTATAAGATCAAAGG + Intronic
1096932986 12:55236559-55236581 TAATGGGATTGCTGGATCGAAGG - Intergenic
1097109322 12:56646469-56646491 TAGTGAGATTGCAAGCTCCCAGG + Intergenic
1097306599 12:58075699-58075721 TAATGGGATTGCTGGGTCAAAGG + Intergenic
1098193105 12:67971540-67971562 TAATGGGATTGCTGGGTCAATGG + Intergenic
1098200395 12:68048548-68048570 GAGTGGGATTGCTAGGTCATAGG - Intergenic
1098507477 12:71270792-71270814 TAATGGGATTGCTAGGTCAATGG - Intronic
1099226112 12:79971572-79971594 AAGTAGGATTGCTGGATCAAAGG - Intergenic
1099378436 12:81923457-81923479 AAGTGGGATTGCAGGATCATAGG + Intergenic
1099739841 12:86620182-86620204 CAGTGGGATTTCCAGATCAGAGG - Intronic
1100022712 12:90089632-90089654 TAATGGGATTGCTGGGTCAAAGG + Intergenic
1101344553 12:103874225-103874247 TAGTAGGGTTGCAAGATTCAAGG + Intergenic
1101776002 12:107794364-107794386 TGGTGGGATTGCTATATGAAAGG - Intergenic
1102784542 12:115593694-115593716 TAGTGGGATTGCTGGATCAAAGG + Intergenic
1103250695 12:119497427-119497449 CAATGGGTTTGCAAGAGCAAGGG + Intronic
1103677714 12:122669415-122669437 GAGTGGGATTAGAAGATCAAAGG + Intergenic
1106465324 13:30008867-30008889 GAGTGGGATTGCTAGGTGAAAGG + Intergenic
1106492879 13:30244443-30244465 TAATGGGATTGCTGGATCAAAGG + Intronic
1106652712 13:31708885-31708907 TAGTGAGATTGCTAGATTAAAGG - Intergenic
1106905476 13:34404831-34404853 GAGTGGAATTGCTAGATCATGGG - Intergenic
1106959022 13:34976046-34976068 TAGTGGGATTGCTGGATCAAAGG - Intronic
1107223349 13:38014188-38014210 TAGCGGGATTGCTGGATCATAGG + Intergenic
1107417661 13:40216444-40216466 GAGTGGGATTAGAAGATGAATGG - Intergenic
1107553357 13:41496898-41496920 TGGTGGGAATGCAATACCAATGG + Intergenic
1107967862 13:45613786-45613808 TAGTGGGATAGCAAGAACATAGG + Intronic
1109376686 13:61504173-61504195 TAGTGGGATTGCTGGATCATAGG + Intergenic
1109834306 13:67836293-67836315 AAGTGGAATTGCTAGATCATAGG - Intergenic
1110379390 13:74833149-74833171 TAGTTTGATGGCAAGAACAAAGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110777510 13:79425784-79425806 AAGTGGGATTGCTAGGTAAAAGG + Intergenic
1111383138 13:87485660-87485682 CATTGGGATTGCAGGATCATTGG - Intergenic
1111595803 13:90408469-90408491 CAGTGGGATTGCTGGATCATAGG + Intergenic
1111619296 13:90703134-90703156 AATTGGGATTGCTAGATCATAGG + Intergenic
1111868209 13:93796414-93796436 TACTGTGATTGCTAGGTCAAAGG - Intronic
1112099445 13:96170878-96170900 AAGTAGGAATGCCAGATCAAGGG + Intronic
1112161800 13:96875941-96875963 TAGAAGGATAGAAAGATCAATGG - Intergenic
1112823224 13:103360026-103360048 TAGTGGGATTGCTGGATCATTGG - Intergenic
1115341687 14:32299575-32299597 TAGAGGAATTGCTAGGTCAAGGG - Intergenic
1115931326 14:38498841-38498863 TAGTGGGATTACTGGATCAAAGG + Intergenic
1116291355 14:43046514-43046536 TACTTGGATTGCCAGATAAAGGG - Intergenic
1117607731 14:57447892-57447914 TAGTAGGATTGCAAGATACAAGG - Intergenic
1118199248 14:63657042-63657064 TGCTGGGATAGCAAGATCAGGGG + Intergenic
1118880182 14:69819154-69819176 TACTGTGGTTGAAAGATCAAGGG - Intergenic
1119345472 14:73920078-73920100 AAGTGGGATTCCTAGGTCAAAGG + Intronic
1119368752 14:74119497-74119519 AAGTGGAATTGCTAGATCATAGG + Intronic
1121198870 14:92100240-92100262 TAATGGAATTGCTAGATCATAGG - Intronic
1121673421 14:95731670-95731692 GAGTGGGATTGCTGGGTCAAAGG - Intergenic
1122608194 14:102962277-102962299 AAGTGGGATTGCCAGGGCAAAGG - Intronic
1123162902 14:106297014-106297036 TAGTGGGATTGGTAGAATAAAGG + Intergenic
1124391024 15:29257524-29257546 AAGTGGCATTGCTGGATCAACGG + Intronic
1125451790 15:39815770-39815792 TAGTGGGATTGCTGAATCATGGG - Intronic
1125456540 15:39865822-39865844 AAGTGGGATTGCTGGGTCAAAGG - Intronic
1125857969 15:42969035-42969057 TAATGGGATTGCTGGGTCAAAGG + Intronic
1126258960 15:46664325-46664347 TAGTGGGATTGCTGAATCATAGG - Intergenic
1126578001 15:50216429-50216451 AAGTGGGATTGCTGGATCAATGG - Intronic
1127023003 15:54772039-54772061 TGTTGGAACTGCAAGATCAAGGG + Intergenic
1127917525 15:63467341-63467363 AAGTGGTATTCCAAGGTCAAAGG - Intergenic
1128329049 15:66744050-66744072 AAGTGGGATTGCCAGGTCAAAGG + Intronic
1129085411 15:73084666-73084688 TGGTGGGATTGCTGGATCATAGG + Intronic
1129907637 15:79200255-79200277 AAGGGAGATTGCAGGATCAAAGG + Intergenic
1130009931 15:80143291-80143313 TAGTAAGATTGCAGGATAAAAGG + Intergenic
1130405747 15:83599712-83599734 TAGTGGGATTGCTGGATCAATGG + Intronic
1131446395 15:92501389-92501411 TAATGGGATTGCTGGGTCAAAGG - Intergenic
1131660891 15:94514796-94514818 TAGTGGGATTGCTGGATTAATGG - Intergenic
1132159271 15:99522650-99522672 TAGTGGGATTGCTGGATATATGG - Intergenic
1132242414 15:100268318-100268340 TAATGGGATTGCTGGGTCAAAGG + Intronic
1132472820 16:116046-116068 CAGTGGGACTGCTAGATCTAAGG + Intronic
1133666766 16:7975783-7975805 AAGTGGGATTGCTGGATCACAGG - Intergenic
1133734677 16:8605919-8605941 AAGTGGAATTGCAGAATCAAAGG - Intergenic
1133753285 16:8741777-8741799 TATTGGGATTGCAAGAACCTGGG + Intronic
1134177179 16:12016795-12016817 AAGTGGGATTGCTGGGTCAAAGG + Intronic
1134359049 16:13513460-13513482 TAATGGGATTGCTGGGTCAATGG - Intergenic
1135354706 16:21759568-21759590 AAGTGAGATTGCTAGATCACAGG + Intronic
1135453194 16:22575707-22575729 AAGTGAGATTGCTAGATCACAGG + Intergenic
1135787485 16:25363296-25363318 TAGTGGCATTGCTGGGTCAAAGG + Intergenic
1136039679 16:27568380-27568402 TAGTGATATTGCTAGCTCAAAGG + Intronic
1136180030 16:28545096-28545118 AAGTGGGACTGCAATATCAGGGG - Intergenic
1136652665 16:31686193-31686215 AAGTGGAATTGCTAGATCATAGG - Intergenic
1136772408 16:32852745-32852767 TAGTGGGATTGGTAGAATAAAGG - Intergenic
1136898207 16:34008772-34008794 TAGTGGGATTGGTAGAATAAAGG + Intergenic
1137852931 16:51764254-51764276 TAGTGGCATTTCCAGATGAATGG - Intergenic
1138396248 16:56706980-56707002 TAGTGGAATTGCTGGGTCAATGG + Intronic
1138402322 16:56756661-56756683 TAATGGGATTGCTGGGTCAATGG + Intronic
1138435014 16:56993487-56993509 GAGTGGATTTGCAAGGTCAAGGG + Intronic
1138631972 16:58303553-58303575 AAGTGGGATTACTAGATCATAGG - Intronic
1138708559 16:58942697-58942719 TAGTGGGATTGTTGGATCATAGG + Intergenic
1139160487 16:64501409-64501431 TAGTGGGATTGCTGGATCTATGG + Intergenic
1139276147 16:65729355-65729377 AAGTGGGCTTGCAGGATCCAGGG - Intergenic
1140003310 16:71048358-71048380 TAGTGGGATTGCTGGATCATAGG + Intronic
1140301508 16:73762450-73762472 TAATGGGATTGCTGGGTCAAAGG - Intergenic
1203074830 16_KI270728v1_random:1114843-1114865 TAGTGGGATTGGTAGAATAAAGG - Intergenic
1142579664 17:933651-933673 TAGTGGGAGGCCAAGATGAAAGG - Intronic
1142826794 17:2517961-2517983 AAGTGGAATTGCCAGATCACAGG - Intergenic
1145387208 17:22423240-22423262 GAGTGGGATTTCAGGATCATAGG - Intergenic
1146920904 17:36710447-36710469 AAGTGGAATTACTAGATCAAAGG + Intergenic
1148284768 17:46378285-46378307 TAGTGGGATTGCTGGATGGAAGG + Intergenic
1148306989 17:46596207-46596229 TAGTGGGATTGCTGGATGGAAGG + Intronic
1149152825 17:53590409-53590431 TAGTGGGATTGCTAGTCGAATGG - Intergenic
1150895957 17:69211101-69211123 TAGTAGGATTGCTGGATCAAAGG - Intronic
1151324888 17:73373382-73373404 TAGTGGGATTGCTGGATCATTGG + Intronic
1153353480 18:4108310-4108332 TAGTGTGATTGGAGGACCAATGG - Intronic
1156023622 18:32627439-32627461 TGGTGCTATTGCAAGAACAATGG - Intergenic
1156339010 18:36194561-36194583 AAGTGGAATTGCTAGGTCAAAGG + Intronic
1157956705 18:52106584-52106606 GAATGGGATTGTAAGATCATAGG - Intergenic
1158417087 18:57257988-57258010 TAATGGGCTGGAAAGATCAAAGG + Intergenic
1158460103 18:57639001-57639023 AAGTGTGATTGCCAGGTCAAAGG + Intergenic
1159091513 18:63854346-63854368 CAGTGGGATTGCTGGATCATAGG + Intergenic
1159451590 18:68609438-68609460 AAGTAGGATTACTAGATCAAAGG - Intergenic
1159575736 18:70174468-70174490 TAGTGGCATTACTAGTTCAAAGG - Intronic
1159717599 18:71846460-71846482 TAGTAGGATTGCTGGATCACTGG + Intergenic
1160429666 18:78802787-78802809 TAATGGGATTGCTAGGTCAAAGG - Intergenic
1161928382 19:7318532-7318554 AAGTGGGATTGCTGGATCATAGG + Intergenic
1162614973 19:11792126-11792148 TAGTGGGATTGCTGGATCAAAGG + Intergenic
1163089381 19:15008530-15008552 CAGTGGGATTGCTGGATCAAAGG - Intronic
1164158155 19:22608751-22608773 AAGTGGGATTGCCAGGTCTAAGG + Intergenic
1164912492 19:32024365-32024387 TAGTGAGATTGCAGGTTAAATGG + Intergenic
1165082274 19:33315195-33315217 AAGTGGAATTGCAAGTTGAAAGG - Intergenic
1165540251 19:36487309-36487331 GAGTGGCATTGCTAGATCATAGG - Intronic
1166030968 19:40127475-40127497 AAGTGGGATTGCTAGATCTAAGG - Intergenic
1166150470 19:40870389-40870411 CAGTGGGATTGCTGGATCATAGG + Intronic
1167135836 19:47614905-47614927 AAGTGGGATTGCTAGATCAAGGG + Intronic
1167190252 19:47983264-47983286 AGGTGGGAATCCAAGATCAATGG + Intronic
926451713 2:13012193-13012215 TAGTGGGATTGCTGGATCATAGG + Intergenic
926459079 2:13105681-13105703 AAGTGGGATTGCAGGGTCAAAGG + Intergenic
927644116 2:24864911-24864933 AAGTGGAATTGCTGGATCAAAGG - Intronic
928059333 2:28095099-28095121 TGGTAGGATTGCCAGGTCAACGG + Intronic
928279537 2:29932491-29932513 TAGTGGAATTGCCGGCTCAAGGG + Intergenic
928525731 2:32138179-32138201 TAATGGGATTTCAGGGTCAAAGG + Intronic
928793098 2:34982140-34982162 TAATGGGACTGCTAGATTAATGG + Intergenic
928909045 2:36400209-36400231 TAGTGGGATTGAAGAATTAATGG + Intronic
929880119 2:45829201-45829223 AAGTGGAATTGCAAGATTAAAGG + Intronic
929952064 2:46419586-46419608 AAGTGGGATTTCTAGATCATAGG - Intergenic
930440493 2:51398351-51398373 TAGTGGGATTGCTGGATCAAAGG - Intergenic
930880595 2:56265766-56265788 TAGTGAGACTGCTGGATCAAAGG - Intronic
930944038 2:57049619-57049641 TAGTAAGATTGCTGGATCAATGG + Intergenic
931448097 2:62344119-62344141 AAGTGGAATTGCTAGGTCAAAGG + Intergenic
931521369 2:63100738-63100760 TAGTGGGATTGCCAGATCATAGG + Intergenic
931543124 2:63351789-63351811 TAATGGGATTGCTGGATTAAAGG + Intronic
931575910 2:63718275-63718297 TAGTGAGATTGCTGGATCAAGGG + Intronic
932069538 2:68604936-68604958 ATGTGGGATTGCTAGGTCAAGGG + Intronic
932106584 2:68948623-68948645 AGGTGGGATTGAAAGAGCAATGG + Intronic
932394276 2:71429577-71429599 TAGAGAGATTTCAAGGTCAAAGG - Intronic
932402504 2:71490972-71490994 AAGTGGGATTACTAGATCAAAGG + Intronic
932788519 2:74630852-74630874 TAATGGGATTGCTGGGTCAAAGG + Intronic
933096999 2:78197587-78197609 TAGTGGGACTGCTGGATCATAGG - Intergenic
933947743 2:87301447-87301469 TAGAGGAATGGCAAGTTCAAAGG + Intergenic
935000368 2:99008647-99008669 AAGTGGGATTGCTGGGTCAATGG - Intronic
935225900 2:101052813-101052835 AAGTGGTATTGCAAGATAAATGG - Intronic
936261667 2:110965344-110965366 TAGTGGGATTGCTGGATCGTAGG + Intronic
936332459 2:111560126-111560148 TAGAGGAATGGCAAGTTCAAAGG - Intergenic
936510397 2:113140598-113140620 TAGTGGGATTGCTGAATCAAAGG + Intergenic
936617862 2:114066829-114066851 GAGTGGGATTGCAAACTCCATGG - Intergenic
936728662 2:115355068-115355090 TAATGGGATTGCTGGGTCAAAGG + Intronic
936827856 2:116603661-116603683 TAATGGGATTGCTGGGTCAAAGG - Intergenic
937878675 2:126848757-126848779 GAGTGGAATTGCAGGATCATGGG - Intergenic
938237609 2:129719093-129719115 AAGTGGGATTGCTGGATCATAGG - Intergenic
938872157 2:135490617-135490639 TAGTGGAATTGCTGGATCATTGG - Intronic
938955745 2:136296515-136296537 TAGTGGTATTGCTGGATCATAGG + Intergenic
939135035 2:138283555-138283577 AAGTGGGATTGCTAGATCATAGG - Intergenic
939310568 2:140470040-140470062 TAATGGGATTCCAAGAACAGGGG - Intronic
940056165 2:149514488-149514510 TAGTGGGATTGGGGGCTCAAAGG + Intergenic
940306631 2:152233980-152234002 AAGTGGGATTGTTAGGTCAAAGG + Intergenic
940410572 2:153359208-153359230 AACTGGAATTGCCAGATCAAAGG + Intergenic
940956555 2:159734928-159734950 GAGTGCAATTGCATGATCAAGGG - Intronic
941707863 2:168678805-168678827 TAGTGGGATTGCTGGATCATAGG - Intronic
943125482 2:183790623-183790645 AAGTGGGATTGCTGGATCATAGG + Intergenic
943177209 2:184492006-184492028 TAATGGGATTGCTGGGTCAAAGG - Intergenic
943256294 2:185597714-185597736 CAATGGGATTGCTAGATCATAGG - Intergenic
944006334 2:194912363-194912385 AAGTGAGATTGCTGGATCAAAGG - Intergenic
944342348 2:198616997-198617019 TAATGGGATTGCCGGATCAAAGG - Intergenic
945713092 2:213324755-213324777 TAGTGGAATTTCTGGATCAAGGG + Intronic
945840094 2:214877304-214877326 AAGTGTGATTGCTGGATCAATGG + Intergenic
945939908 2:215938220-215938242 TAGTGAAATTGCAGAATCAAAGG - Intergenic
946214300 2:218172050-218172072 TAGTGGAATTTCAGCATCAAAGG - Intergenic
947879985 2:233499527-233499549 TAATGGGATTGCTGGATCAATGG + Intronic
948564071 2:238872328-238872350 TAGGGGGATTGCAAGGCCAGAGG + Intronic
1170121239 20:12914815-12914837 TTCTGGGGTTGCAAGATCAGAGG - Intergenic
1170809235 20:19660656-19660678 TAGTGGGATTGCTGGATTGAAGG + Intronic
1171276444 20:23860185-23860207 TAGTGGAATTGCTGGATCACAGG + Intergenic
1171362637 20:24599455-24599477 TAGTGGGATTGCTGGGTCAAAGG - Intronic
1172171063 20:32932799-32932821 AAGTGGGATTGCTAGGTAAAAGG + Intronic
1172529769 20:35621911-35621933 AAGTGGAAGTGCTAGATCAAAGG - Intergenic
1173044415 20:39495864-39495886 GAGTGGAATTGCTGGATCAATGG - Intergenic
1173201475 20:40958327-40958349 GAGTGGGATTGCTATGTCAAAGG - Intergenic
1173540455 20:43847256-43847278 TAGTAGGATTGCTAGATCAAAGG + Intergenic
1174084560 20:47997321-47997343 TAGTGAGGTTGCAAGATACAAGG - Intergenic
1174600744 20:51722811-51722833 TAGTGGGATTGGTGGATCAATGG - Intronic
1175292558 20:57886592-57886614 TAGTGGGATTGCTAGATCAAAGG + Intergenic
1175548971 20:59803832-59803854 AAGTGGGATTTCCAGATCAAAGG + Intronic
1177137815 21:17325315-17325337 CAGTGGGATTGCTGGATCATAGG - Intergenic
1177209903 21:18058323-18058345 TAGTTGGATTGCTGGATCATAGG - Intronic
1178069603 21:28948904-28948926 AAGTGGAATTGAAAGCTCAAAGG + Intronic
1178101990 21:29279854-29279876 GAATGGGATTACTAGATCAAAGG - Intronic
1178107748 21:29339139-29339161 AAGTGGGATTGTTGGATCAAGGG + Intronic
1178636021 21:34304703-34304725 AAGTGGGATTGCTGGATCATAGG - Intergenic
1178962397 21:37077428-37077450 AAATGGGATTGCTAGATCAAGGG + Intronic
1178967070 21:37130921-37130943 TAGTGGGATTGCTGTATCAAAGG + Intronic
1181366811 22:22382943-22382965 TCGTGAGATTGCTGGATCAAAGG + Intergenic
1181373174 22:22434084-22434106 TCGTGAGATTGCTGGATCAAAGG + Intergenic
1181905413 22:26191208-26191230 TAATGGGATTGCTGGGTCAAAGG - Intronic
1182679675 22:32068885-32068907 TAGTGAGATTGCTGGATCATAGG - Intronic
1182937445 22:34238742-34238764 TAGTGGGATTGCTGAGTCAATGG - Intergenic
1182970762 22:34573981-34574003 TAGCAGGATTGCTGGATCAATGG + Intergenic
1183758397 22:39792255-39792277 TAGTGGGATTGCTGGGCCAATGG + Intronic
1183786509 22:40032027-40032049 CAGTTGGATGGCAAGTTCAAGGG + Exonic
1183794642 22:40105792-40105814 GAGTGGGATTGCTGGATCATGGG + Intronic
1185121154 22:48971880-48971902 TAGTGGGATTGCTGAATCAAAGG - Intergenic
950213931 3:11144173-11144195 TAGTGAGATTGCTGGATCAAAGG - Intronic
950246595 3:11425341-11425363 AAGTGGAATTGCTAGATTAAAGG + Intronic
950293108 3:11803537-11803559 TAATGGGATTGCTAGATCAAAGG - Intronic
950596007 3:13982306-13982328 CAGTGGGATTGCTGGATCATTGG + Intronic
950895208 3:16443091-16443113 TAATGGGATTGCTAGATCATAGG + Intronic
951296821 3:20947155-20947177 TAATAGGATTGCAGGGTCAAAGG + Intergenic
952322805 3:32293965-32293987 AACTGGGGTTGCAGGATCAAGGG + Intronic
952721416 3:36537166-36537188 TAATGGGATTGCTGGGTCAAAGG - Intronic
953984361 3:47429931-47429953 TAGCGGGTTTTGAAGATCAAAGG + Intronic
954167913 3:48775629-48775651 AAATGGAATTGCAATATCAAAGG - Intronic
954492834 3:50923287-50923309 TAGTGGGATTGGTGGATCAATGG + Intronic
954573470 3:51661513-51661535 AAGTGGGATTGCCAGGTCAAAGG + Intronic
955004877 3:54959111-54959133 TAATAGGATTGCCAGATAAAGGG - Intronic
955581990 3:60433434-60433456 AAGTGGTATTGCTAGATCATGGG + Intronic
957306118 3:78460919-78460941 TAGTGGGATTGCTGGATCAAAGG + Intergenic
957419045 3:79944860-79944882 GAGTGGGATTGCTAGATCAAAGG - Intergenic
957691998 3:83582737-83582759 TAGTAGGATTGCTGGATCACAGG + Intergenic
957840123 3:85657008-85657030 AAATGGGATTGCATGATAAACGG - Intronic
958049386 3:88324943-88324965 TGGAGAGTTTGCAAGATCAAAGG + Intergenic
958444449 3:94197744-94197766 TAGTGGGATTGCTGCATCAATGG + Intergenic
959109835 3:102109258-102109280 AAGTGGGATTGCTGGATCACAGG + Intronic
959229093 3:103624269-103624291 TAGTGGAATTGCTGGATCATAGG + Intergenic
959283224 3:104374160-104374182 TAGTGGGATTGCTGGGTCAAAGG - Intergenic
959692537 3:109214098-109214120 TAGTAGAATTGCAAGATCAATGG + Intergenic
959714866 3:109421731-109421753 TAGTGTTATTGGAAGAGCAAAGG + Intergenic
960683961 3:120278790-120278812 TAATGGGATTGCTGGGTCAAAGG - Intronic
961665714 3:128492320-128492342 TAGTGGGATTTCAATAAGAATGG - Intronic
961787233 3:129354477-129354499 AAGTGGGATTGCCGGATCATAGG - Intergenic
961948660 3:130721370-130721392 AAGAGGGATTGCAAGATCACAGG - Intronic
963333111 3:143938585-143938607 TAATGGGATTGCTGGTTCAAAGG - Intergenic
964204311 3:154154934-154154956 AATTAGGATTGCTAGATCAAAGG + Intronic
964442308 3:156724871-156724893 AAGTGGGATTGTTGGATCAAAGG + Intergenic
964458553 3:156895831-156895853 TAATGGGATTGCTGGGTCAATGG - Intronic
964820639 3:160764977-160764999 AAGTGGGATTTCTGGATCAAAGG + Intronic
964854725 3:161134351-161134373 TAGTGGGATTGCTGGATCATAGG + Intronic
965110128 3:164410283-164410305 TAATGGGATTGCTGGGTCAATGG + Intergenic
966742456 3:183246704-183246726 AAGTGGGATTGCTGGATCATAGG + Intronic
967050716 3:185781848-185781870 TAGTGGGTTTGAAGCATCAAAGG + Intronic
967184833 3:186935521-186935543 TAATGGGATTGCTGGGTCAATGG + Intronic
968083306 3:195862287-195862309 CAGTGGGACTGCTAGGTCAAAGG - Intergenic
968544467 4:1191704-1191726 TAGTGGGAGTGCAAGGACAGAGG + Intronic
969080383 4:4613245-4613267 AAGTGGGATTGCTGGATCAAAGG - Intergenic
970627131 4:17898843-17898865 AAATGGGATTGCTAGGTCAAAGG + Intronic
971829156 4:31667833-31667855 TAGGGTCATTGCAAGAACAATGG - Intergenic
973010095 4:45062208-45062230 TAATGGGATTGCTGGGTCAATGG - Intergenic
973601889 4:52550548-52550570 TAGTGTGATTGCAAGATAAAAGG - Intergenic
973654831 4:53035948-53035970 TAATGGGATTGCTGGGTCAATGG - Intronic
974094448 4:57347469-57347491 TAATGGGATTGCTAAATCAAAGG + Intergenic
974889805 4:67867940-67867962 TAGTTGGATTGCTGGATCAAAGG - Intronic
975656546 4:76646892-76646914 TAGTGGGATTGCTGGCTCAAAGG - Intronic
975941311 4:79650175-79650197 TAATGGGATTGCTGGGTCAAAGG + Intergenic
976136508 4:81943050-81943072 TAGAGGGATTGCTAAATCATAGG - Intronic
976232980 4:82865371-82865393 AAGTGGGATTGCTGGATCATAGG - Intronic
977706647 4:100079300-100079322 AAGTGGTATTGCAAGATGACAGG - Intergenic
977874637 4:102134459-102134481 TACTGGGATTGGATGATCTATGG + Intergenic
977930087 4:102741410-102741432 TAGTGGGATTGCTGGATCAATGG - Intronic
978156298 4:105492610-105492632 TAATGGGATTGCTGGGTCAAAGG + Intergenic
978168517 4:105638950-105638972 AAGTGAAATTGCTAGATCAAAGG + Intronic
978253690 4:106666474-106666496 TAGTGGGATTGCTGGATCAAAGG + Intergenic
978572134 4:110149252-110149274 CAGTGGGATTGCTGGATCAAAGG - Intronic
978998988 4:115194281-115194303 TAATGGGATTGCTGGATCAAAGG + Intergenic
979062366 4:116079497-116079519 TAATGGGATTGCTGGGTCAAAGG + Intergenic
979896865 4:126169491-126169513 TAGAGGGATTGCTAGATTGAAGG - Intergenic
980032995 4:127852137-127852159 TAGTGGGATTGCTAGATTGAAGG - Intergenic
980309409 4:131106037-131106059 AATTGGGATTTCAAGATAAATGG - Intergenic
980548173 4:134297150-134297172 TAATGGGATTGCTGGATCGATGG - Intergenic
981502895 4:145471573-145471595 CAGTGGGGTTGCTGGATCAAAGG + Intergenic
981865099 4:149407869-149407891 TAGTGGGATTGCTGGATCAAAGG + Intergenic
982375574 4:154686818-154686840 CAGTGGGATTGCAGGATCATAGG + Intronic
982656352 4:158154482-158154504 TAGTGGGATTGCTGGATCAAAGG - Intronic
982907093 4:161088290-161088312 TAGTGGGATTACAGGATTGAAGG - Intergenic
983013896 4:162584829-162584851 TAGTGTGATTGCTGGATCAATGG - Intergenic
983663970 4:170161733-170161755 AGGTGGGATTACAAGGTCAAAGG + Intergenic
984261531 4:177448881-177448903 TAGTGGGATTGCTGGATCGAAGG + Intergenic
984266012 4:177498718-177498740 TAGTGGGATTGCTGGATCAAAGG + Intergenic
984634705 4:182098306-182098328 CAGTGGGATTGCTGGATCATAGG - Intergenic
984731485 4:183072262-183072284 TTGTGGAATTGCTAAATCAAAGG - Intergenic
984734166 4:183095672-183095694 TACTGGGATTGCTGGATTAAAGG + Intergenic
984831361 4:183977708-183977730 TAGTGGGATTGCTGGATCAAAGG + Intronic
986868715 5:12020853-12020875 TTGTGGAATTGCAAGGCCAAAGG - Intergenic
987010421 5:13757224-13757246 TAATGGGATTGCTGGGTCAATGG + Intronic
988460897 5:31437023-31437045 GAGTGAGATTACAAGATGAAAGG - Intronic
988636028 5:32985975-32985997 TAGTGGGATTGCTGGATCAATGG - Intergenic
989159165 5:38373780-38373802 TAGTGGGATTGCTGGCTCAGTGG + Intronic
989564114 5:42884466-42884488 AGGTGAGAGTGCAAGATCAAAGG - Intronic
989628085 5:43451721-43451743 TAGTGGGATTGCTGGATCAAAGG - Intronic
989826028 5:45856523-45856545 TAGTAGGATTTCTGGATCAATGG + Intergenic
990013396 5:51027421-51027443 CAGTGGGATAACAAGAGCAAAGG + Intergenic
990529659 5:56660705-56660727 TTGTGGGGTTGAAAGATCAATGG - Intergenic
990858080 5:60293955-60293977 GAGTGGAATTGCTAGGTCAAAGG + Intronic
992116556 5:73543885-73543907 TAGTGGAATTGCCTGATCACAGG - Intergenic
993651136 5:90524001-90524023 AAGTGGGATTGCCAGATAAGAGG - Intronic
993847734 5:92966512-92966534 TAGTGGAATAGCAAGTGCAAAGG + Intergenic
993956981 5:94246289-94246311 AAGTGGGATTCCCAGAGCAACGG + Intronic
994667553 5:102724324-102724346 AAGTGGGATTGCTGGTTCAAAGG - Intergenic
994953731 5:106499316-106499338 AAGTGTGATTGCTGGATCAAAGG + Intergenic
995446564 5:112251255-112251277 TAGTGGGATTGCTAGGTCATAGG - Intronic
995476835 5:112556618-112556640 AAGTAGGATTACTAGATCAAAGG + Intergenic
996250767 5:121328700-121328722 TAATGGGATTGCTGGGTCAATGG + Intergenic
996782656 5:127204957-127204979 AAGTGGGATTGCTGGATCAAAGG - Intergenic
996900962 5:128540555-128540577 AAGTGGAATTGCTGGATCAAAGG - Exonic
997104633 5:131004979-131005001 TAGTGGGATTGCTGGATGATTGG - Intergenic
997326801 5:133028352-133028374 TAGTAGGATTGCTGGGTCAAAGG + Intergenic
997952819 5:138255535-138255557 TAGTACCATTGCCAGATCAAAGG - Intronic
998681265 5:144470243-144470265 CAGTGGGACTGCAAGGTCAAAGG + Intronic
998998126 5:147889012-147889034 AAATTGAATTGCAAGATCAAAGG - Intronic
999022183 5:148178651-148178673 TAATGGGATTGCTGGGTCAAAGG + Intergenic
1000003786 5:157164628-157164650 AAGTGGGATTGCACAGTCAAGGG + Intronic
1000362245 5:160458361-160458383 GAATGGGATTAGAAGATCAAAGG - Intergenic
1001007969 5:168071734-168071756 GAGTGGAATTGCCAGCTCAAAGG + Intronic
1001161959 5:169327216-169327238 TAATGAGATTGCAGGGTCAATGG - Intergenic
1001165277 5:169359917-169359939 TAGTGGGACTGCTGGATCAATGG - Intergenic
1001974129 5:175982847-175982869 AAGTGAAATTGCTAGATCAATGG - Intronic
1002243305 5:177860932-177860954 AAGTGAAATTGCTAGATCAATGG + Intergenic
1002916374 6:1531191-1531213 AAGTGGGATTGCTAGGTCAAAGG + Intergenic
1004106980 6:12674897-12674919 TAGAGGCATGGCATGATCAAAGG + Intergenic
1004164625 6:13245202-13245224 TAACGGGATTGCAAGGTCGACGG + Intronic
1004465984 6:15885275-15885297 TAGTGGAACTGTTAGATCAAAGG + Intergenic
1004955198 6:20721582-20721604 TAGTGGGATTGCTGGACAAATGG + Intronic
1005701139 6:28401492-28401514 AAGTGGTATTGCAGGAACAAAGG - Intergenic
1005760902 6:28967334-28967356 TAGTGGGATTACTGGATCAAAGG - Intergenic
1005800926 6:29423518-29423540 TATTGGGATTGCTGAATCAAAGG + Intronic
1006978795 6:38128862-38128884 TAGTGGGATTGCCGGATCAATGG + Intronic
1007010672 6:38414604-38414626 TAGTGGGGGTGGAAGACCAATGG - Intronic
1007051290 6:38833004-38833026 TAGTGAGAATGCAAAATCAATGG - Intronic
1007526152 6:42495332-42495354 GAGTGGGATTGCTGGATCGAAGG + Intergenic
1008566903 6:52777559-52777581 TAGTGGAATTGCTAGGTCATTGG + Intergenic
1008570446 6:52811623-52811645 TAGTGGAATTGCTAGGTCATTGG + Intergenic
1008734456 6:54526050-54526072 TAATGGGATTGCTAGTTAAATGG - Intergenic
1008836492 6:55838160-55838182 CAGTGGGATTGCCAAATCATTGG + Intronic
1008949943 6:57145818-57145840 TAGTGGGACTGCTGGATCAAAGG + Intronic
1009060418 6:58391914-58391936 TAATGGGATTGCTGGATAAAAGG - Intergenic
1009230493 6:61055420-61055442 TAATGGGATTGCGGGATCAAAGG + Intergenic
1009279395 6:61727896-61727918 TAATGGGATTGCTGGGTCAAAGG - Intronic
1009604425 6:65848687-65848709 TGGTGAGATTGCTGGATCAAAGG + Intergenic
1010140084 6:72603465-72603487 TAGAGGGATTGCTGGATCATAGG + Intergenic
1010322919 6:74533955-74533977 TAGTGGGCTGGCACAATCAATGG - Intergenic
1010388199 6:75306690-75306712 TAATGGGATTTCAAGGTCAAAGG - Intronic
1010457198 6:76070438-76070460 CAGTGGGATTGCTGGATCAAAGG - Intronic
1011016370 6:82760231-82760253 TAGTGGGATTGCTGGATTGATGG - Intergenic
1012015918 6:93851260-93851282 TAGTGGGATTGCTGGAAGAATGG + Intergenic
1012169002 6:95995011-95995033 CAGTGGGATTGCTGGATCAAAGG - Intergenic
1013306964 6:108857362-108857384 TAGTAGGGTTGCAAGATACAAGG - Intronic
1013565761 6:111359965-111359987 GAGTAGGATTGCCACATCAATGG - Intronic
1013983333 6:116160133-116160155 TGGTGGGGTTGCTGGATCAAAGG + Intronic
1014290000 6:119547418-119547440 CAATGGGATTGCAAGAATAAGGG - Intergenic
1014412758 6:121147336-121147358 TAGTGGGATTGCTAGGTTGAAGG + Intronic
1014617013 6:123615270-123615292 TAGTAGGATTCCTGGATCAATGG - Intronic
1015014891 6:128400320-128400342 TAGAGGAAAAGCAAGATCAAAGG + Intronic
1015034591 6:128638287-128638309 CCATGGAATTGCAAGATCAAAGG + Intergenic
1015320997 6:131874661-131874683 TAGTGGGATTGCTAGATTAGGGG - Intronic
1015720704 6:136238059-136238081 AAGTGGGATTGCTGGATCATAGG - Intronic
1016425164 6:143927659-143927681 TAGTTGGATTGCTGGATCAAAGG + Intronic
1016710028 6:147159733-147159755 TACTGAGATAGAAAGATCAAAGG + Intergenic
1017781411 6:157718300-157718322 TAGTAGGATTGCCAGATCCAAGG + Intronic
1017921220 6:158873923-158873945 TAGTGAGATTGCAGGATACAAGG - Intronic
1018037726 6:159895850-159895872 AAGTGGAATTGCTAGACCAAAGG - Intergenic
1019856279 7:3611565-3611587 GAGTGGGATTGCTAGATGAAAGG + Intronic
1019905876 7:4064536-4064558 TAGTGGGATTGCTGGCTCATAGG - Intronic
1020390718 7:7654976-7654998 TAGTAGGATTGCAGGACCTATGG + Intronic
1020494966 7:8838941-8838963 TAGTGTGGTTGCTGGATCAAAGG + Intergenic
1020534663 7:9381772-9381794 TAGAGGGATTGCTGGATAAAAGG + Intergenic
1020678706 7:11209843-11209865 TAGTGAAATTGCATGATCAAAGG - Intergenic
1021138721 7:16996696-16996718 TAATGGGAATGCTAGGTCAATGG + Intergenic
1021553138 7:21893205-21893227 AAGTGGGATTGCCAGATAACAGG + Intronic
1022763830 7:33387242-33387264 AAGTGGGATTGTTAGGTCAAAGG + Intronic
1022903005 7:34828745-34828767 TTGTGGAATTACTAGATCAAAGG + Intronic
1022986333 7:35657961-35657983 TAGTGGGATTGCTGGATCATAGG - Intronic
1025065643 7:55853151-55853173 CAGTGGGATTGCTGGATCATAGG - Intronic
1026067341 7:67086600-67086622 GAGTGGGAGTTCAAGTTCAAAGG + Intronic
1026709582 7:72725727-72725749 GAGTGGGAGTTCAAGTTCAAAGG - Intronic
1026923279 7:74171850-74171872 TAGTGGTATTGCAGGATTACAGG - Intergenic
1027338432 7:77179677-77179699 TAGTGGGATTGCTGGGTCAGTGG + Intronic
1027387678 7:77674756-77674778 GAGTGTGATTGCTAGATCATGGG + Intergenic
1027721846 7:81752625-81752647 TAGTGAGATTTCAAAATCAGTGG - Intronic
1028020111 7:85760254-85760276 TAGTGGGATTGCTGGATCGATGG - Intergenic
1028434709 7:90789048-90789070 AAGTGCCATTGCAAGGTCAAAGG - Intronic
1028760559 7:94491417-94491439 AAGTGGGATTGCTGGATCCAAGG - Intergenic
1029660364 7:101956596-101956618 AAGTGGGATTGCTGGGTCAAAGG - Intronic
1029871900 7:103703327-103703349 TAGTGGGATTGCAATTTGGAGGG - Intronic
1030013301 7:105192566-105192588 TAGTGGGATTGCTGGATCAATGG + Intronic
1030409081 7:109152319-109152341 GAGTGAAATTGCAAGATCCAAGG + Intergenic
1031186486 7:118487369-118487391 TAGTGTAATTGCTGGATCAATGG - Intergenic
1031863989 7:127017370-127017392 ATGTGGGATGGCAAGATCAAGGG - Intronic
1032436572 7:131905847-131905869 TAGTGGGCTTGGAGGATCCATGG + Intergenic
1032449293 7:132015725-132015747 TAGTGGGATTGCTGGATAAATGG - Intergenic
1032599055 7:133273516-133273538 TAGGGGGATGGCAGGAACAAAGG - Intronic
1032888318 7:136166049-136166071 CAGTGAGATTACAAGATGAATGG + Intergenic
1032891758 7:136203050-136203072 TAGTGGGGTTGCTGGGTCAAAGG + Intergenic
1032939726 7:136775273-136775295 TAATGGGATTGCTGGGTCAAAGG + Intergenic
1033083746 7:138322812-138322834 AAGTGGGATTGCTAGATCATAGG - Intergenic
1033160266 7:138990082-138990104 TAGTGGGATTGCTGGACCATAGG + Intergenic
1033387810 7:140895941-140895963 TAGTGGGATTGCTAGATCACAGG + Intronic
1033717281 7:144015828-144015850 TAATGGGATTGCTGGGTCAATGG - Intergenic
1033981016 7:147166002-147166024 TAGTAGGACTGCTGGATCAAAGG - Intronic
1034195762 7:149245819-149245841 AAGTGGGATTGCTAGGTAAAAGG + Intronic
1034518137 7:151597931-151597953 TAGTGGGATTGCTGGATCATAGG - Intronic
1034549467 7:151811049-151811071 AGGTGGGATTGGAAGAACAAAGG + Intronic
1034888359 7:154816807-154816829 TAGTGTAAGTGCAAGATCCAGGG - Intronic
1034994117 7:155567333-155567355 CAGTGGGGTTGCTAGATCATAGG - Intergenic
1035130452 7:156647700-156647722 TAGTGGGATTGCTGGATCGAGGG + Intronic
1035223969 7:157423641-157423663 AAGTGGGATGGCCAGGTCAAAGG + Intergenic
1037371747 8:18187320-18187342 TAATGGGATTGCTGGGTCAATGG - Intronic
1038911111 8:31965573-31965595 TAGTGGTATTGCTAGGTCAATGG + Intronic
1038985953 8:32810691-32810713 TAATGGGATTGCTGGGTCAAAGG - Intergenic
1040656646 8:49518338-49518360 TGGTGGGATTGCTGGGTCAAAGG - Intergenic
1042803075 8:72742225-72742247 GAATGGGATTCAAAGATCAATGG - Intronic
1043142039 8:76602650-76602672 TAGAGGAATTTCAGGATCAAAGG - Intergenic
1043370812 8:79590218-79590240 TAGTGGGATTGCTGGATCATAGG - Intergenic
1043932974 8:86111604-86111626 TAGTGAGATTGCTAGATCATAGG + Intronic
1044431711 8:92115194-92115216 AAGTGGGATTGCTGGATCATAGG + Intergenic
1044682134 8:94792180-94792202 CAGTGGGTTTGCAGTATCAAGGG - Exonic
1044789307 8:95830781-95830803 TAGTAAGATTGCATGATAAAAGG + Intergenic
1044915655 8:97110481-97110503 GAGTGGGATTGCCAGGTCACAGG + Intronic
1046120890 8:109845331-109845353 TAGTGGGACTGCTGGATCAGAGG + Intergenic
1046209375 8:111047620-111047642 TAGTGGGATTGCTGAATCATAGG - Intergenic
1047799024 8:128289637-128289659 TACTAGAATTGCAGGATCAAAGG - Intergenic
1048486597 8:134853707-134853729 CAGTGGGATTGCTGGATCAAAGG + Intergenic
1050400728 9:5250875-5250897 TAGAGGGATTGCTGGATCAAGGG - Intergenic
1050495413 9:6235918-6235940 TAGTGGAATTGCTGGATCAGAGG - Intronic
1050503744 9:6326161-6326183 TAATGGGATTGCTGGATTAATGG + Intergenic
1050624006 9:7484503-7484525 TAATGGGATTGCTGGGTCAAAGG - Intergenic
1050798646 9:9580228-9580250 TAGTGGGATTGCTGGATCAAAGG + Intronic
1051010887 9:12412618-12412640 AAGTGGAATTGCTAGATCATAGG - Intergenic
1051325535 9:15963459-15963481 CAGTGGAATTGCTAGGTCAAAGG + Intronic
1051625983 9:19100551-19100573 CAGTGGGATTGCTGGATCATAGG - Intronic
1052097594 9:24402980-24403002 TAATGGGATTGCTGGATCAATGG - Intergenic
1052185285 9:25586521-25586543 TAATGGGATTGCTGGGTCAAAGG - Intergenic
1052204500 9:25822713-25822735 CAGTGGGATTGCTGGATCACAGG + Intergenic
1052380667 9:27767484-27767506 TAATGGGATTGCTGGGTCAATGG - Intergenic
1052394378 9:27921259-27921281 TAGTGGAATTGCTGGACCAAAGG - Intergenic
1052550161 9:29937989-29938011 GAGTGAGATTCCCAGATCAATGG + Intergenic
1052698055 9:31904566-31904588 TAGTGGGGTTGCTGGATCAATGG - Intergenic
1052737685 9:32360636-32360658 TAGTGGTATTGCTGGATCATGGG - Intergenic
1052737742 9:32361618-32361640 TAGTGGGATTGCTGGATCATGGG - Intergenic
1052753255 9:32514199-32514221 TAATGGGATTGCTGGGTCAAAGG - Intronic
1053131509 9:35618180-35618202 AAGTGGGGATGCAGGATCAAGGG + Intronic
1054900269 9:70361458-70361480 AAGTGGATTTGCTAGATCAAAGG - Intergenic
1056681045 9:88719324-88719346 TTGTGGGATTTAAATATCAATGG + Intergenic
1057461070 9:95262594-95262616 AAGTGGGATTGCTGGATCAATGG - Intronic
1057526728 9:95809656-95809678 TGCTGGGTTTGCCAGATCAAGGG + Intergenic
1057896700 9:98914979-98915001 TAGTGGGATTGCTGGGTCAGGGG + Intergenic
1058012681 9:99995891-99995913 TAGTGGGATTGCTGGATCATAGG + Intronic
1058374867 9:104310893-104310915 TAATGGGATTGCTGGGTCAAAGG - Intergenic
1059058304 9:111007740-111007762 AAGTAGGATTGCTAGGTCAAAGG - Intronic
1059086749 9:111311236-111311258 CAGTGGGATTGCTGGATCATAGG + Intergenic
1059264517 9:113013814-113013836 AAGTGAGATTGCTGGATCAAAGG + Intergenic
1059406963 9:114107212-114107234 AAGTGGAATTGCTAGATCATGGG - Intergenic
1060354190 9:122888839-122888861 AAGTGGGATTGCTAGACCAAAGG + Intronic
1060611493 9:124969762-124969784 TAGTAGAATTGCAAGATCAGAGG - Intronic
1060754332 9:126201623-126201645 CAGTGAAATTGCTAGATCAAAGG - Intergenic
1185829764 X:3289471-3289493 TAATGGGATTGCTGGGTCAAAGG - Intergenic
1185832938 X:3318656-3318678 TAGTGGGATTGCTAGACCATAGG - Intronic
1186013327 X:5162734-5162756 TAGTGGGATTGCTGGATTATAGG + Intergenic
1186173678 X:6903412-6903434 TAGTGGGATTGCTGGGTCAAAGG - Intergenic
1187240136 X:17505322-17505344 CAGTGGAATTGCCAGTTCAAAGG + Intronic
1187441563 X:19325472-19325494 AAGTGGAATTGCTAGGTCAATGG - Intergenic
1187518376 X:19991965-19991987 TAGTGGGATTTCAACATTTAAGG - Intergenic
1188080347 X:25831194-25831216 TAGTAGGATTGCTGGATCACAGG + Intergenic
1188089596 X:25947347-25947369 TAGTGGGATTGCTGGATCACAGG - Intergenic
1188529131 X:31118609-31118631 AAGTGAGATTGCTGGATCAAAGG - Intronic
1188597050 X:31914354-31914376 CAGTGGGATTGCTGGATCATAGG - Intronic
1188767024 X:34106205-34106227 AAGTGGGATCGCTGGATCAATGG + Intergenic
1188896265 X:35672075-35672097 TAATGGGATTGCCAGTCCAATGG - Intergenic
1189810612 X:44777644-44777666 GAGTGGAATTGCTAGATCACAGG + Intergenic
1189899172 X:45688014-45688036 TAATGGGATTGCTGGGTCAAAGG + Intergenic
1189899591 X:45692439-45692461 TAATGGGATTGCTGGGTCAAAGG - Intergenic
1189963038 X:46343206-46343228 ATGTGGGATTGCTAGGTCAAGGG + Intergenic
1190127014 X:47715068-47715090 TAATGGGATTGCTAGGTCAAGGG - Intergenic
1191199024 X:57758451-57758473 AGGTGGGATTGCTAGATCACAGG - Intergenic
1192285823 X:69734994-69735016 AAGTGGGATTGCTGGATCATAGG - Intronic
1192944629 X:75951941-75951963 TAGTGGAATTGCTAGATCAAAGG + Intergenic
1193018576 X:76764195-76764217 TAGTGAAATTGCTGGATCAAAGG - Intergenic
1193044952 X:77043162-77043184 TAATGGGATTGCTGGGTCAATGG - Intergenic
1193128771 X:77897564-77897586 AAGTGGGATTGCTGGATTAAAGG - Intergenic
1193255824 X:79348085-79348107 TAGTGGGATTGCTGAATCCAAGG - Intergenic
1193302927 X:79913827-79913849 TAGTGGGATTGGAGGGTCATAGG - Intergenic
1193597928 X:83470420-83470442 TAATGAGATTGTAAGGTCAAGGG + Intergenic
1193830488 X:86283352-86283374 TAATGGGATTGCTGGATCAATGG - Intronic
1194032522 X:88834228-88834250 TAGTGGGATTTCTGGATCAATGG - Intergenic
1194547256 X:95252548-95252570 TAGTAGGATTGCTGGATCAAAGG + Intergenic
1194627050 X:96237599-96237621 TAATGGGATTGCTGGGTCAAAGG + Intergenic
1195881631 X:109598794-109598816 AAGAGGTATTGCCAGATCAAAGG - Intergenic
1195912947 X:109906965-109906987 TAGTGGAATTGCTGGATCAAAGG + Intergenic
1196801634 X:119548685-119548707 AAGTGGGATTGCTGGATCATAGG - Intronic
1197483234 X:127013328-127013350 TAGTGGGATTGCTAGATGTATGG + Intergenic
1197973452 X:132139323-132139345 TAGTGGGATTGCTGGATTGAAGG + Intergenic
1198493024 X:137162760-137162782 TAGAGGGATAGAAAGAACAAAGG + Intergenic
1199065557 X:143413013-143413035 TAGTGGTATTACTAGATAAAAGG + Intergenic
1200272930 X:154703862-154703884 CAGTGGGATTGCTGGATCTATGG - Intronic
1201243158 Y:11978212-11978234 TAGTGGGATTGCTAGACCATAGG + Intergenic
1201607799 Y:15806785-15806807 TAGTGGCATTGATAAATCAATGG - Intergenic