ID: 1070376397

View in Genome Browser
Species Human (GRCh38)
Location 10:75835469-75835491
Sequence CTGTGAATTCATATGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 607}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070376397_1070376402 5 Left 1070376397 10:75835469-75835491 CCTTTTTCCATATGAATTCACAG 0: 1
1: 0
2: 2
3: 57
4: 607
Right 1070376402 10:75835497-75835519 GAAAATTCATGGACATATTTGGG No data
1070376397_1070376403 6 Left 1070376397 10:75835469-75835491 CCTTTTTCCATATGAATTCACAG 0: 1
1: 0
2: 2
3: 57
4: 607
Right 1070376403 10:75835498-75835520 AAAATTCATGGACATATTTGGGG No data
1070376397_1070376404 9 Left 1070376397 10:75835469-75835491 CCTTTTTCCATATGAATTCACAG 0: 1
1: 0
2: 2
3: 57
4: 607
Right 1070376404 10:75835501-75835523 ATTCATGGACATATTTGGGGTGG No data
1070376397_1070376401 4 Left 1070376397 10:75835469-75835491 CCTTTTTCCATATGAATTCACAG 0: 1
1: 0
2: 2
3: 57
4: 607
Right 1070376401 10:75835496-75835518 TGAAAATTCATGGACATATTTGG No data
1070376397_1070376400 -6 Left 1070376397 10:75835469-75835491 CCTTTTTCCATATGAATTCACAG 0: 1
1: 0
2: 2
3: 57
4: 607
Right 1070376400 10:75835486-75835508 TCACAGGTTCTGAAAATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070376397 Original CRISPR CTGTGAATTCATATGGAAAA AGG (reversed) Intronic
900818357 1:4867796-4867818 CTCTTCAATCATATGGAAAAAGG - Intergenic
901429547 1:9204753-9204775 ATGTGACTTTATTTGGAAAAAGG - Intergenic
902059997 1:13634118-13634140 ATGTGACTTTATTTGGAAAAAGG + Intergenic
902704416 1:18194695-18194717 ATGTGAATTTATTTGGAAATAGG - Intronic
902843182 1:19088438-19088460 CAGTTACTTCATCTGGAAAATGG + Intronic
902948150 1:19858513-19858535 CTGTGTTTTCATCTGTAAAATGG + Intergenic
903229309 1:21912227-21912249 CTGTGTCTTCATCTGTAAAATGG + Intronic
903380173 1:22891118-22891140 CTGTGTCTTCATCTGTAAAAGGG - Intronic
904114517 1:28151745-28151767 CTGTGACCTCACATGGCAAAAGG - Intronic
904259083 1:29277734-29277756 CTGTGACTTCTTCTGTAAAATGG - Intronic
904679273 1:32217459-32217481 CTGTGACTTCATCTGGAAGATGG - Intronic
905520452 1:38595366-38595388 ATGTGACTTCATTTGGAAGAAGG + Intergenic
905634377 1:39539600-39539622 CTTTGGATTTATATGGAACATGG - Intergenic
905758427 1:40532244-40532266 CAGTTAACTCATATGCAAAATGG - Intronic
907524885 1:55048344-55048366 CTGTGACCTTATTTGGAAAAAGG - Intronic
907883483 1:58572697-58572719 CTGTGATTCCACTTGGAAAATGG + Intergenic
909009443 1:70318068-70318090 ATATGAAGTCATATAGAAAAGGG - Intronic
909053927 1:70800479-70800501 ATGTGACTTCATTTGGAAATAGG - Intergenic
909142389 1:71884815-71884837 CTTTAAATTCACATGGACAAAGG + Intronic
909277688 1:73709258-73709280 CTGTCATTTAATATGGAAATTGG - Intergenic
909419409 1:75447003-75447025 CTGTGCTTTCTTATGGCAAATGG - Intronic
909679296 1:78273975-78273997 CTGTGAATTCATCTGGCCCAGGG + Intergenic
910249913 1:85186407-85186429 CTGTGAATCCATCGTGAAAATGG + Intronic
910423030 1:87089720-87089742 CTGTGAACTCATTTTGAAAATGG - Intronic
910726022 1:90339871-90339893 CTGTCAATTCACATTAAAAATGG - Intergenic
911369891 1:96984219-96984241 CAGTGTCTTCATCTGGAAAATGG - Intergenic
911413785 1:97544885-97544907 GTGTGAATTCATAGTGAAAATGG - Intronic
911926215 1:103835634-103835656 CTGTGAAATCATCTGGAAGGGGG + Intergenic
912119948 1:106458674-106458696 ATGTGAAACCATATGGTAAATGG - Intergenic
912764005 1:112392556-112392578 CTGTGAATTTATTTAGAAATAGG + Intergenic
913596311 1:120381151-120381173 CTGTGGAGTGATATGGAAGAAGG + Intergenic
914090961 1:144497824-144497846 CTGTGGAGTGATATGGAAGAAGG - Intergenic
914307639 1:146436385-146436407 CTGTGGAGTGATATGGAAGAAGG + Intergenic
914594469 1:149136753-149136775 CTGTGGAGTGATATGGAAGAAGG - Intergenic
915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG + Intergenic
916089040 1:161292645-161292667 CTTTGCATTTATATGTAAAATGG - Intergenic
916185783 1:162131531-162131553 CTGTGATTTCCCATGGAAAGAGG + Intronic
916189648 1:162166702-162166724 CTGTCAATTCTTTTGTAAAATGG + Intronic
916606901 1:166351926-166351948 GTGAGACTTCAAATGGAAAAGGG - Intergenic
916641516 1:166733482-166733504 CTGTGAATTCATCTGGTCCAGGG - Intergenic
918841188 1:189541755-189541777 CTGTAACTTCATATGGCAGAAGG - Intergenic
918967063 1:191364639-191364661 CTGTGAACTCGTATGAGAAAGGG + Intergenic
920603227 1:207350464-207350486 CTGTGAATCCATCTGGTACAGGG + Intronic
920607692 1:207405827-207405849 CTGGGACTTCATATTTAAAAAGG - Intergenic
921228014 1:213039658-213039680 CTGTTAATTAACATGGAAAATGG - Intergenic
921726572 1:218530918-218530940 CTGTCAATTCCTATGTAAATGGG - Intergenic
922858374 1:228794643-228794665 ATGTGAGCTTATATGGAAAAAGG - Intergenic
922958096 1:229622522-229622544 CCGTGATTTCAAAAGGAAAATGG - Intronic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
923085029 1:230696740-230696762 ATGTGAACACATTTGGAAAAGGG - Intergenic
923390866 1:233513768-233513790 CTGTGTCTTCATGTGGAAGAAGG + Intergenic
923414982 1:233748122-233748144 CTGTGAAGTCACATGGCAATGGG - Intergenic
923515121 1:234690704-234690726 CTGAAAATTGATATGGAAGAAGG + Intergenic
923999636 1:239536094-239536116 CTCTGAATTCAGATGGAATTTGG - Intronic
924439392 1:244073893-244073915 ATGTGACCTCATTTGGAAAAAGG - Intergenic
1063102221 10:2960535-2960557 GTGTCAATTCTTCTGGAAAAAGG - Intergenic
1063741063 10:8820412-8820434 GTGTGAACTTTTATGGAAAAAGG + Intergenic
1063822932 10:9857999-9858021 CTGTGATTTTATCTGGAAGATGG - Intergenic
1063904644 10:10769188-10769210 CTTTGAGTTCATCAGGAAAAGGG - Intergenic
1063985716 10:11499492-11499514 CTGTGACCTCATCTGGAAATGGG + Intronic
1064416210 10:15152484-15152506 CTGTCACTTCCTAAGGAAAAGGG - Intronic
1064505051 10:16019620-16019642 GTGTCAGTTCATGTGGAAAATGG + Intergenic
1064990387 10:21251733-21251755 CTGTGTCCTCATATGGCAAAAGG - Intergenic
1065793356 10:29282206-29282228 CTTTGAAATGATAAGGAAAAAGG - Intergenic
1065862990 10:29886998-29887020 ATGTGAGTTCACATGGAAAAGGG - Intergenic
1066236650 10:33491318-33491340 CTGTGAATTCATATAGTATTTGG + Intergenic
1067188298 10:44048899-44048921 TAGGGAATTCATATTGAAAAAGG + Intergenic
1067816443 10:49481148-49481170 CTGTGAATCTACATGGAAAGAGG + Intronic
1068382648 10:56277056-56277078 CTATCAATTCAGAGGGAAAAAGG + Intergenic
1068723621 10:60275394-60275416 CTATGACTTCATTTGGAAAAGGG + Intronic
1069766460 10:70864253-70864275 CTGTGAAATCATATGAAAAGCGG - Intronic
1070370988 10:75781804-75781826 CTGTGATCTCATCTGCAAAATGG - Intronic
1070376397 10:75835469-75835491 CTGTGAATTCATATGGAAAAAGG - Intronic
1070853594 10:79587024-79587046 TTGTGAAGTCCTATGGCAAAGGG - Intergenic
1070858255 10:79627312-79627334 TTGTGAAGTCCTATGGCAAAGGG + Intergenic
1071501774 10:86209352-86209374 CTGTGAATTCACATGTACAAAGG - Intronic
1071714311 10:88079700-88079722 CTGCAAAGTCATATGGCAAAAGG + Intergenic
1071853513 10:89599822-89599844 ATGTGACTTTATTTGGAAAAAGG + Intronic
1073244469 10:102079804-102079826 ATGTGACTTTATTTGGAAAAAGG + Intergenic
1073401925 10:103264820-103264842 CAGTTTATTCATTTGGAAAATGG + Intergenic
1073999260 10:109352301-109352323 CTGTGAATTCATCTGAAACACGG + Intergenic
1074759041 10:116651530-116651552 CTGTGAATTCATATGGTCCTGGG + Intergenic
1075062808 10:119268595-119268617 CTGTGTTTTCATCTGTAAAATGG + Intronic
1076272896 10:129170214-129170236 GTGTGAATTCTCATGGAAAAAGG - Intergenic
1076593669 10:131609761-131609783 CTGTGTATTCATAAGCAATAGGG + Intergenic
1077805452 11:5587545-5587567 CTGTGTCTTCACATGGAGAAAGG + Intronic
1077829200 11:5846124-5846146 CTATGAATACAGAAGGAAAAGGG - Intronic
1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG + Intergenic
1078731515 11:13979369-13979391 ATGTGAACTCATTTGGAAATAGG - Intronic
1078738938 11:14048543-14048565 CTTTGCATCCAAATGGAAAATGG - Intronic
1078925826 11:15874086-15874108 TTGTGATTTTATTTGGAAAAAGG - Intergenic
1081532754 11:43974502-43974524 CTGTGAACTTATTTAGAAAAGGG - Intergenic
1081576524 11:44321940-44321962 ATGTGACTTTATTTGGAAAAAGG - Intergenic
1081748835 11:45493183-45493205 CTGAAAATTCATATTGCAAAGGG + Intergenic
1082078868 11:47996476-47996498 CTGTTACTGCATCTGGAAAATGG + Intronic
1083214494 11:61210004-61210026 CTATGAATCCATAAGGAAATGGG - Intronic
1083217378 11:61228833-61228855 CTATGAATCCATAAGGAAATGGG - Intronic
1083220369 11:61248581-61248603 CTATGAATCCATAAGGAAATGGG - Intronic
1084744398 11:71159464-71159486 GTGTGACCTCATATGGCAAAAGG - Intronic
1085013741 11:73159193-73159215 CAGTGTATTCATTTGTAAAATGG + Intergenic
1085424313 11:76390354-76390376 CAGTTAATTCATCTGTAAAAGGG + Intronic
1086158230 11:83692323-83692345 CTGTAAATTTATCTGTAAAATGG + Intronic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1087332144 11:96793688-96793710 CCGTGAATTCTTATATAAAATGG + Intergenic
1087434131 11:98091037-98091059 ATGTGAATTCCTTTGGAAACAGG + Intergenic
1087494933 11:98879543-98879565 CTGTGTATTCACAAGGCAAAAGG + Intergenic
1087539482 11:99497221-99497243 CTGTGAAATTTTATGGAAACAGG + Intronic
1087604665 11:100362797-100362819 CTGTGAATTCATCTGGTCCAGGG + Intergenic
1087764670 11:102137610-102137632 CTGTGATTTCACATGGAGCAGGG - Intronic
1088019139 11:105098105-105098127 CTATGTATACATATGGAAGAAGG + Intronic
1088184868 11:107155631-107155653 GTGAGTATTCATATGGCAAAAGG + Intergenic
1088766246 11:112982303-112982325 ATCTGAATTCATTTGTAAAAAGG + Intronic
1088962633 11:114684749-114684771 ATTTTAATTCATATGGAAAAAGG + Intronic
1089362077 11:117897609-117897631 CTGTTTCTTCATATGTAAAATGG - Intergenic
1090232518 11:125118818-125118840 CTTTGAATTGTTCTGGAAAATGG + Intergenic
1090658322 11:128862322-128862344 GTGTGAATTCTTATGCACAATGG + Intronic
1090886446 11:130881022-130881044 CTGTGTCCTCATATGGCAAAAGG - Intronic
1093079748 12:14795874-14795896 CTGTGCCTTCATCTGTAAAATGG + Intronic
1094325014 12:29228334-29228356 CTGTTTTTTCATCTGGAAAATGG + Intronic
1095669697 12:44844080-44844102 CTGTGACTTCATGTGGCAAAAGG + Intronic
1096936001 12:55277267-55277289 CTGATAATTTATAAGGAAAAAGG + Intergenic
1098084288 12:66825315-66825337 GTGTAAAGTCATATGGAGAAAGG - Intergenic
1098110674 12:67118332-67118354 GTGTGAATTCCTATGTAGAAAGG + Intergenic
1098450644 12:70614581-70614603 CTGTGAATACTTAAGCAAAAAGG + Intronic
1098574642 12:72027463-72027485 TTGAGTATTCATCTGGAAAATGG - Intronic
1098747509 12:74258728-74258750 CTGAGAAATCATGGGGAAAAAGG - Intergenic
1098799299 12:74933820-74933842 CTGTGAAGTCAAAGTGAAAATGG - Intergenic
1099026622 12:77472226-77472248 CTGAGAATAAATATGGCAAATGG + Intergenic
1099558497 12:84142512-84142534 ATGAGAATTCATAAGGCAAAGGG - Intergenic
1099836968 12:87919129-87919151 CTGTGATTTCATTTGGAAATGGG - Intergenic
1099906093 12:88771991-88772013 CTGTAAATAAATATTGAAAATGG + Intergenic
1100040814 12:90314691-90314713 CTGTGGATGCATATGAAAAATGG + Intergenic
1100188889 12:92168853-92168875 CCATGAATTCATAAGGAAGAGGG - Intergenic
1100192328 12:92205946-92205968 ATGTGAACTTATCTGGAAAAGGG - Intergenic
1100588726 12:96004269-96004291 CTATGATTTCATCTGGAGAATGG - Intronic
1100699729 12:97134473-97134495 ATGTGATTTTATTTGGAAAAGGG + Intergenic
1100814205 12:98369995-98370017 CTGTGATTTCATCTGTAAAATGG - Intergenic
1101448078 12:104752376-104752398 ATGTGATTTGATATGGAAATAGG - Intronic
1102413371 12:112739522-112739544 CTGTCATTCCATATGGAAATGGG - Intronic
1102630563 12:114275034-114275056 CTGGGATTTCATTTGGAGAAAGG - Intergenic
1103311236 12:120010469-120010491 ATAAGATTTCATATGGAAAAGGG + Intronic
1103801397 12:123540113-123540135 CTGTGACCTCATTTGAAAAATGG - Intergenic
1103829648 12:123768531-123768553 CTGTGACCTCATTTGGAAACAGG - Intronic
1104354724 12:128075363-128075385 ATGTTAAGTCACATGGAAAAGGG + Intergenic
1104469817 12:129020535-129020557 ATGTGAATGCATTTGGAAATAGG - Intergenic
1105832576 13:24177433-24177455 CTGTGTCTTCATATGGTGAAGGG + Intronic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106396293 13:29384134-29384156 CTGTGAATATATCTGGAGAAAGG + Intronic
1106866007 13:33964778-33964800 ATGTCACTTCATTTGGAAAAAGG + Intronic
1107405757 13:40111266-40111288 TTGTGAATTCATACAGAAAGAGG + Intergenic
1107557808 13:41533220-41533242 CTTTCAATTCATATTGCAAATGG + Intergenic
1108167142 13:47705252-47705274 ATGTGACTTTATTTGGAAAAAGG - Intergenic
1108679508 13:52767387-52767409 CTGTGTCTTCACATGGAAGAAGG - Intergenic
1108751985 13:53456959-53456981 ATGTGAACTCATCTGGAAATAGG + Intergenic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109752099 13:66707933-66707955 CTGAGAATTGATATGAAAATTGG - Intronic
1109787487 13:67198418-67198440 CTGTGAATTCAAAAGAAAACTGG - Intronic
1109974302 13:69811001-69811023 CTGTGAATCCATCTGGTATAGGG - Intronic
1110506002 13:76286953-76286975 CTCTGAATTGATATGGCACATGG - Intergenic
1110915240 13:81012770-81012792 CTGTGAATCCATCTGGTACAGGG + Intergenic
1111788713 13:92825149-92825171 CTGTGATTTCAGCTGGAGAAGGG - Intronic
1112117552 13:96373233-96373255 CTGTGACCTTATTTGGAAAAAGG - Intronic
1112195266 13:97219561-97219583 CTGTGTCTTCACATGGTAAAGGG + Intergenic
1112601379 13:100858846-100858868 ATGTGACTTCATCTGGAAATAGG + Intergenic
1112963290 13:105155413-105155435 AAGTGAATGCCTATGGAAAAGGG - Intergenic
1113501189 13:110775719-110775741 CTGTGACCTCACATGGCAAAAGG - Intergenic
1113833251 13:113313446-113313468 ATGTGATTCCAAATGGAAAAAGG + Intronic
1114719637 14:24867194-24867216 CTGTGTCCTCATATGGCAAAAGG - Intronic
1114834119 14:26183225-26183247 CTCTGAAGTCATATTGCAAAGGG - Intergenic
1115145384 14:30220203-30220225 ATGTAAATTCATAAGGAAGATGG + Intergenic
1116089949 14:40292356-40292378 CTGTGAATCCATCTGGACCAGGG + Intergenic
1116360098 14:43983421-43983443 ATGAGTAGTCATATGGAAAAGGG + Intergenic
1116657361 14:47669524-47669546 CTGAGATTTCACATGCAAAATGG - Intronic
1116687597 14:48060416-48060438 CTGTTAATTCATACAGAAATTGG - Intergenic
1117254939 14:53968181-53968203 CTTTGAATTTACATGCAAAAAGG + Intergenic
1117366608 14:55035761-55035783 CAGTGCATTCACATGTAAAATGG - Intronic
1117775554 14:59180703-59180725 GTGTGACTTTATTTGGAAAAAGG + Intergenic
1118506084 14:66413533-66413555 CAGTGAACTCATCTGCAAAATGG + Intergenic
1118673543 14:68157498-68157520 CTGAGAAGTCATTTGGAACATGG + Intronic
1119149288 14:72343510-72343532 ATGTGACTTCACATGGCAAAAGG - Intronic
1120631617 14:86898747-86898769 CAGTGAATGCATATTGAAAATGG - Intergenic
1120825529 14:88951382-88951404 ATGTGACTTTATTTGGAAAATGG + Intergenic
1121157513 14:91700519-91700541 CTGTGAATTCATCTGGTCCAGGG + Intronic
1121165764 14:91796488-91796510 ATGTGAACTCATTTGGAAACAGG + Intronic
1122017373 14:98807706-98807728 CTGTGTCTTCATTTGTAAAATGG + Intergenic
1124857279 15:33401629-33401651 GTGTGATGTCATATGGAAAAAGG + Intronic
1124987012 15:34629693-34629715 ATGTGTACTAATATGGAAAAGGG + Intergenic
1124992819 15:34692699-34692721 CTGTGTCTTCATAGGGCAAAAGG - Intergenic
1126264032 15:46731349-46731371 CTGTGTGCTCATATGGCAAAAGG + Intergenic
1127833147 15:62768512-62768534 ATGTGATCTCATGTGGAAAAAGG - Intronic
1127854562 15:62943684-62943706 CTGTGAAGATATCTGGAAAAGGG - Intergenic
1128330866 15:66754728-66754750 CAGTGAATCCATCTGTAAAATGG - Intronic
1129684915 15:77680264-77680286 ATGTGAGTTCATGTGGTAAACGG + Intronic
1130581560 15:85141751-85141773 ATGTGACTTCATGTGGAAATAGG - Intergenic
1130689712 15:86071294-86071316 CTGTGTCTTTATATGAAAAAGGG + Intergenic
1130744983 15:86642166-86642188 CTGTAAAGTCATATGGAAACAGG + Intronic
1130968080 15:88711740-88711762 CTGCGACTTCATCTGTAAAATGG + Intergenic
1131599063 15:93828622-93828644 ATGTGACTTTATTTGGAAAATGG - Intergenic
1134183056 16:12062984-12063006 CTGTGTCCTCATCTGGAAAATGG + Intronic
1134429993 16:14194460-14194482 ATGTGACTGCATTTGGAAAAAGG - Intronic
1135887782 16:26327551-26327573 CTGTGTATTTATATTTAAAATGG - Intergenic
1137434186 16:48442113-48442135 TTGTAAAATCATATGGAAATAGG + Intronic
1137886950 16:52115375-52115397 ATGTTAATTTATATGGCAAAAGG - Intergenic
1138888730 16:61114697-61114719 ATGTTAATTTATATGGCAAAGGG + Intergenic
1139078598 16:63485737-63485759 CTGTGATTTATTTTGGAAAAAGG - Intergenic
1140649403 16:77070449-77070471 CTTGGAATTTATGTGGAAAAAGG + Intergenic
1140779305 16:78279892-78279914 GTGTGAGTGCATAGGGAAAAGGG + Intronic
1141266917 16:82506052-82506074 ATGTGACTTCATAGGGTAAATGG - Intergenic
1141638140 16:85326331-85326353 CAGTGAACTCATCTGTAAAATGG + Intergenic
1141674698 16:85511593-85511615 ATGTGAACTTATTTGGAAAAGGG + Intergenic
1142510632 17:390446-390468 CTGTGACTTTATTTGGTAAAAGG + Intergenic
1142750805 17:1986412-1986434 CTGTGACCTTATTTGGAAAAAGG + Intronic
1142915775 17:3136025-3136047 ATGTGACTTCATCTGGAAAGAGG + Intergenic
1144360997 17:14492671-14492693 CTGTGATTTCACATGGCAAAAGG + Intergenic
1144583095 17:16471054-16471076 ATGTGACCTCATTTGGAAAAAGG + Intronic
1144798307 17:17907532-17907554 CTGTGAAATCAGAGAGAAAATGG + Intronic
1145026879 17:19475083-19475105 CTGTGGATTCATCTGGAATAGGG + Intergenic
1145843106 17:28013003-28013025 CTCTGGATTCATATGTTAAAGGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146783627 17:35698709-35698731 CTGTAAAGCCATTTGGAAAAAGG - Intronic
1147178336 17:38670375-38670397 ATATGACTTCATTTGGAAAAAGG + Intergenic
1148236574 17:45973138-45973160 CTTTGGATTAATTTGGAAAATGG + Intronic
1149060471 17:52415379-52415401 CTGTCATCTCCTATGGAAAAAGG - Intergenic
1149211872 17:54312861-54312883 CTGTGATTTCACATGGTAGAAGG + Intergenic
1149244802 17:54693028-54693050 GTGTGTATTCATATGTATAAGGG - Intergenic
1149445913 17:56713349-56713371 CTATTAACTCATATGTAAAATGG + Intergenic
1149447367 17:56724063-56724085 CTGTAAAGTCACATGGAAAAAGG + Intergenic
1149782548 17:59409527-59409549 CTGGGAATGCTTATGCAAAAAGG + Intergenic
1149940716 17:60862419-60862441 CTGTGAATTCATTTGGTCCAGGG + Intronic
1150330893 17:64293431-64293453 CTGTTACTTTATATGGAAAAAGG + Intergenic
1151000625 17:70371099-70371121 CTGTTTATTCAATTGGAAAATGG - Intergenic
1151003081 17:70400875-70400897 ATGTGAATTCATATGGTGGATGG + Intergenic
1151172680 17:72260777-72260799 CAGTAAATTCATTTGTAAAATGG + Intergenic
1151300368 17:73220192-73220214 ATGTGAATTCATATGACAATAGG - Intronic
1152943644 17:83186204-83186226 CTGTGACCTTATTTGGAAAAGGG + Intergenic
1153715561 18:7844239-7844261 ATGTGAATTCTTATGGTAAGAGG - Intronic
1153933831 18:9902846-9902868 ATGTTACTTCATTTGGAAAAGGG + Intergenic
1155179420 18:23331149-23331171 CTGTGACTAATTATGGAAAACGG - Intronic
1155182968 18:23363958-23363980 CTGTGCTTTCATATGGCAAGCGG + Intronic
1156601424 18:38611650-38611672 CTGTACATTCATCTGGAAATTGG + Intergenic
1156770165 18:40710888-40710910 CTTTGTTTTCAAATGGAAAAAGG + Intergenic
1157945243 18:51972199-51972221 TTGTTAATTCATTTTGAAAATGG + Intergenic
1158062369 18:53360967-53360989 CTGTGACCTTAGATGGAAAAGGG + Intronic
1158580734 18:58680239-58680261 GTGTGTATTCATATGAAAAAAGG - Intronic
1159135117 18:64328444-64328466 CTGTGTATGCATAGAGAAAATGG - Intergenic
1159790150 18:72768536-72768558 ATGTTACTTTATATGGAAAAAGG + Intronic
1160053804 18:75461115-75461137 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1160123857 18:76153153-76153175 CAATGAATTCATATGCATAAAGG + Intergenic
1160326289 18:77952117-77952139 ATATGAATTAATTTGGAAAAGGG - Intergenic
1163188261 19:15655579-15655601 CTGTGTATTCTTCTAGAAAATGG + Intronic
1163228952 19:15986293-15986315 CTGTGCATTCTTCTAGAAAATGG - Intergenic
1165366331 19:35368985-35369007 CTGTGAATCCATCTGGTCAAGGG - Intergenic
1165828878 19:38720697-38720719 CTGTGCCTTCATCTGTAAAATGG - Intronic
1166019383 19:40011911-40011933 ATGTGACCTAATATGGAAAAAGG - Intronic
1168102957 19:54150667-54150689 CTGTGCCTTCATCTGGGAAACGG + Intronic
925325703 2:3020318-3020340 ATGTGACCTGATATGGAAAAAGG + Intergenic
925468890 2:4137600-4137622 CTGTGTTTTCATAGGGAGAAGGG + Intergenic
925604994 2:5650515-5650537 CTGTGGAGTGATATGGAAGAAGG + Intergenic
925672063 2:6321182-6321204 CTGTGAATGCATATGGTCCAGGG - Intergenic
926175145 2:10584160-10584182 CCTTGAAATCATATGGAAACTGG - Intronic
926339673 2:11894732-11894754 CTGTTACTTTATATGGAAAAAGG - Intergenic
926422620 2:12715249-12715271 CTCTGATTTCAAATGGAAATTGG - Intergenic
927340179 2:21974310-21974332 CTGTGAAATTATTTGGAATAAGG - Intergenic
927633562 2:24794401-24794423 CTGTTTCTTCATCTGGAAAATGG + Intronic
927658308 2:24971119-24971141 CTTGGAATTCATAAGGGAAAAGG + Intronic
929581613 2:43085128-43085150 ATGTGAAATTATATGGCAAAGGG - Intergenic
930132325 2:47865047-47865069 CTGTTAATTCCTGTGGAAACAGG - Intronic
930360467 2:50371682-50371704 CTGTGCATTTTTATGGAAAGTGG + Intronic
931827875 2:66020043-66020065 ATGTGATCTCATTTGGAAAAAGG - Intergenic
931897227 2:66745544-66745566 TTGTGAATTCATCAGGAAGAAGG - Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
933463305 2:82617277-82617299 CTAGACATTCATATGGAAAAGGG + Intergenic
934235259 2:90226174-90226196 CTTTGAATTCTTTTGGCAAAAGG - Intergenic
934546024 2:95217266-95217288 ATGTGAATTCATGTGGAGACAGG - Intronic
935262517 2:101367650-101367672 ATGTGACTTCATATGGTAACAGG + Intronic
935325432 2:101931634-101931656 ATGTGACTTCATTTGGAAATAGG + Intergenic
935362044 2:102253607-102253629 GTGTGAATTCACAGGTAAAAGGG + Intergenic
935410404 2:102756398-102756420 CTGTTTTTTAATATGGAAAATGG - Intronic
935899855 2:107779853-107779875 CAGTGAATTCATTAGGAAACAGG + Intergenic
936579061 2:113680344-113680366 CTGTGTTTTCACATGGTAAAAGG + Intergenic
936579072 2:113680425-113680447 CTGTGTTTTCACATGGTAAAAGG + Intergenic
936832708 2:116668307-116668329 CTGTGAATTCATCTAGACCAGGG - Intergenic
936954576 2:118011877-118011899 CACTGAAATCAAATGGAAAAGGG + Intronic
937170889 2:119867420-119867442 CAGTGAGTTCATGAGGAAAAGGG + Intronic
937420281 2:121748374-121748396 CTGTGTCTTCATATGGCAGAAGG - Intronic
937728654 2:125198593-125198615 ATGTGACATCATTTGGAAAATGG + Intergenic
938003151 2:127762674-127762696 CGGTTAATTCATATTGTAAAAGG + Intronic
938672461 2:133599139-133599161 CTGTGAACTTATTTGGAAATAGG - Intergenic
939672683 2:145032976-145032998 GTTGGAATTCATATGGAACAGGG + Intergenic
939817004 2:146908797-146908819 CTGAGAAATAATAGGGAAAAAGG - Intergenic
940180997 2:150932660-150932682 CTCAGACTTCAAATGGAAAAAGG - Intergenic
940281832 2:151997129-151997151 ATGTGACCTCATTTGGAAAAAGG + Intronic
940291082 2:152078130-152078152 CTTTGGATTGATATTGAAAATGG - Intronic
940738872 2:157484369-157484391 CTGAGAATCCACATGGGAAATGG + Intronic
941282508 2:163570921-163570943 CTATGAACTCATATGGCAGAAGG - Intergenic
941375133 2:164719304-164719326 CTGTGAATTCAAATTGCAACTGG + Intronic
942002528 2:171663037-171663059 ATGTGACCTCATTTGGAAAAAGG - Intergenic
942254384 2:174080626-174080648 CTATGAATTCAAATTTAAAAAGG + Intronic
943861891 2:192876649-192876671 CTGTTAATGGATATTGAAAATGG - Intergenic
943866627 2:192932156-192932178 CTATGAAGTCATTTGGCAAAAGG - Intergenic
943976605 2:194486726-194486748 CTGTGTCTTTATATGGAAGATGG - Intergenic
944156137 2:196609632-196609654 ATGTTATTTTATATGGAAAAGGG - Intergenic
944314685 2:198271679-198271701 CTATAAATTCATATGGGCAATGG + Intronic
945195486 2:207233526-207233548 CTGTGTCTTCACATGGCAAAAGG - Intergenic
945595982 2:211793527-211793549 CTGTGGCTTCATCTTGAAAATGG - Intronic
946141752 2:217697154-217697176 CTATGAATTCCTGTGGAAATTGG + Intronic
946250266 2:218407062-218407084 CTGTGAATTTATATAGCCAAGGG - Intergenic
946803422 2:223445257-223445279 CTCTGACTACAGATGGAAAATGG + Intergenic
947106085 2:226669158-226669180 CTGCAAAGTCATATGGCAAAGGG + Intergenic
947333567 2:229056106-229056128 CTGAGACTTCATTTGGAAATGGG - Intronic
948081082 2:235205930-235205952 CTGTGAATCAATCTGGAACAAGG + Intergenic
948507908 2:238442749-238442771 CTGGACATCCATATGGAAAAAGG - Intronic
948725519 2:239931439-239931461 ATGTGACCTCATTTGGAAAAGGG - Intronic
1169689838 20:8318062-8318084 CTTGGAATTCATAAGTAAAATGG + Intronic
1169934111 20:10864711-10864733 CTGTGACTTCATAAGCAGAATGG + Intergenic
1170202141 20:13756178-13756200 CAGTTTATTCATATGGAAATTGG - Intronic
1170241204 20:14168734-14168756 CTGTGAATCCACCTGGTAAAAGG - Intronic
1173311124 20:41896889-41896911 CTGCAAAGTCATATGGCAAAAGG + Intergenic
1174067258 20:47874623-47874645 CTGTGTTTTCATCTGCAAAATGG + Intergenic
1174157039 20:48522248-48522270 CTGTGTTTTCATCTGCAAAATGG - Intergenic
1174464229 20:50704643-50704665 CTCTGTATTTATATGTAAAATGG - Intergenic
1174637081 20:52010406-52010428 CTGAGAGTTCTTATAGAAAAGGG - Intergenic
1175130742 20:56787652-56787674 CTCTGAATTCATCTGGAAAACGG + Intergenic
1175653198 20:60746776-60746798 CTGTGGCTTCATAGGGCAAATGG - Intergenic
1176005064 20:62857149-62857171 CTGTGACTTACTATGGAGAAAGG - Intronic
1176029351 20:63004239-63004261 GTGTGAAATCATAAGGAAAAGGG - Intergenic
1177085532 21:16698178-16698200 ATGTGTATTCATAATGAAAATGG + Intergenic
1177201070 21:17956688-17956710 CTGTGTTTTCATATGGCAGAAGG + Intronic
1177551935 21:22634448-22634470 CTGTGTTTTCACAGGGAAAAGGG + Intergenic
1178162082 21:29929431-29929453 CAGTTAGTTCATGTGGAAAAGGG - Intronic
1178264647 21:31131880-31131902 CTGTGGCTTCATATGGCGAAAGG - Intronic
1178357390 21:31920297-31920319 ATGTGACTTTATTTGGAAAAAGG - Intronic
1178898879 21:36583386-36583408 ATGTGACTTCATTTGGAAATAGG - Intergenic
1179061282 21:37981874-37981896 CTGTGGTTTGAAATGGAAAATGG - Intronic
1179326978 21:40356654-40356676 CTTTGAAATCATATTGAGAATGG + Intronic
1180050781 21:45330148-45330170 CTGTGAAGACATTTGCAAAAGGG - Intergenic
1181381278 22:22506816-22506838 CTTTGAGATCCTATGGAAAAGGG + Intronic
1181681134 22:24496507-24496529 TTGTGATTTTATTTGGAAAAAGG - Intronic
1181936271 22:26441168-26441190 CTGTGACTTCACATGGTGAAAGG + Intronic
1182640941 22:31767122-31767144 CAATGAATACATGTGGAAAACGG - Intronic
1182670782 22:31994064-31994086 ATGTGACTTCATTTGGAAATAGG - Intergenic
1183288064 22:36980381-36980403 CCGTTAATTCATAAGAAAAAAGG + Intergenic
1183299300 22:37051132-37051154 CTGTGGCTTCATCTGTAAAATGG + Intergenic
1184245517 22:43233970-43233992 CTGTGACCTCATCTGTAAAATGG - Intronic
1184370465 22:44078613-44078635 CTGTGACTTCACATGGCAAGAGG - Intronic
1185108889 22:48889866-48889888 GTTTGGATTCATTTGGAAAAAGG + Intergenic
949935420 3:9112166-9112188 CTTTGGATTCATCTGGAACATGG - Intronic
951460579 3:22947076-22947098 ATGTGCATTTATATGGAAGATGG - Intergenic
951828929 3:26901878-26901900 CTGTGAATTCATCTGGTCAGGGG - Intergenic
952666978 3:35918934-35918956 CTATGAATTCATATGGTGTAGGG + Intergenic
953332747 3:42067832-42067854 TTGAAAATTCACATGGAAAAAGG - Intronic
953775526 3:45813325-45813347 GCGTGACTTCATTTGGAAAAAGG + Intergenic
954028026 3:47798543-47798565 CTGTGACTGCATTTGGAAATAGG + Intergenic
955264365 3:57427247-57427269 ATGTGATCTTATATGGAAAAAGG + Intronic
955476188 3:59338719-59338741 CTGTTACTTCATGTGCAAAATGG - Intergenic
955532680 3:59890548-59890570 ATGTTAATTCATATGCAAAATGG + Intronic
955767875 3:62363776-62363798 CTGTGTCTTCATCTGCAAAATGG - Intergenic
955806310 3:62739020-62739042 CTATAAATTCATATTGCAAAAGG - Intronic
956559802 3:70562592-70562614 CTGTGAATTCATCTGGCCCATGG + Intergenic
956766574 3:72489299-72489321 CTGTGTCTTCATCTGGAAAATGG - Intergenic
957450984 3:80382035-80382057 CTGTGAATTCATGTGGTCTAGGG + Intergenic
958114393 3:89196603-89196625 AGGTGAAATGATATGGAAAAAGG - Intronic
958439677 3:94140730-94140752 CTGTGAATTCATCTGACAAAGGG - Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959461125 3:106627350-106627372 TTATGAATTTATATAGAAAATGG + Intergenic
959921394 3:111872180-111872202 CTGTGGATACATATGTAATAAGG + Intronic
960124162 3:113979993-113980015 CTGTGAAATCACATTGCAAAGGG - Intronic
960173072 3:114485761-114485783 CTGTATCTTCATATGGCAAAGGG - Intronic
960422758 3:117467845-117467867 CTATCAATTCAGAAGGAAAATGG + Intergenic
960503868 3:118469931-118469953 CTGTGTCTTCATGTGGCAAAAGG + Intergenic
960638690 3:119808011-119808033 CTGGGCATTCAAATGGAAAAGGG + Intronic
960694587 3:120383594-120383616 CTTTGGATTCATATGGATTATGG + Intergenic
961689227 3:128656416-128656438 CTGGGTGTTCATATGGAAGAAGG + Intronic
961850649 3:129814264-129814286 CTGTGAATTCCTATTTAAAGTGG + Intronic
962016653 3:131447932-131447954 ATGTGTCTTCACATGGAAAAAGG + Intergenic
962041625 3:131713236-131713258 ATGTGAGTGTATATGGAAAAGGG + Intronic
962043336 3:131730523-131730545 ATGTGACTTCATATGGAAATAGG + Intronic
962616615 3:137133046-137133068 CTGTGTGTTTATATGTAAAATGG + Intergenic
963391816 3:144674331-144674353 CTATGCCTTCATATGGTAAAAGG - Intergenic
963941335 3:151098703-151098725 ATGTGACCTCATTTGGAAAAAGG - Intronic
964161837 3:153654926-153654948 TTGTGAACTCATATGACAAAGGG - Intergenic
964919440 3:161878453-161878475 CTGTGAATCCATCTGGACCAGGG - Intergenic
965033715 3:163406850-163406872 CTGTTAACTCTTATGGTAAAAGG - Intergenic
965492810 3:169360719-169360741 TTGTTATTTCATATGGAATAAGG + Intronic
965779336 3:172267551-172267573 ATGTGTATTCACATGTAAAATGG + Intronic
965804647 3:172529522-172529544 CTGTGAAGCCACATGGCAAAAGG - Intergenic
966051631 3:175623506-175623528 ATGTGAACTTATATGGAAGAAGG + Intronic
966390210 3:179444540-179444562 CTGTGTATTTAAATGGAACATGG - Intronic
966432838 3:179850586-179850608 GTGTGAGTTCATTGGGAAAATGG - Intronic
966643871 3:182220686-182220708 ATGTCAATTCATGTGGAAACAGG - Intergenic
967226147 3:187293255-187293277 CTGTGTCTTCATTTGGAAAATGG + Intergenic
967260698 3:187638921-187638943 CTGTGTCTTCACATGGCAAAAGG + Intergenic
967265658 3:187689352-187689374 CTATGAATTCTTTTGGTAAATGG - Intergenic
967395364 3:189002540-189002562 CTGTGAATTCATACGCTATATGG - Intronic
968015347 3:195327020-195327042 CTGTGAAATGATTTGGAATATGG - Intronic
969150182 4:5162719-5162741 CTGTGATTTCCTGTGGAAAAAGG + Intronic
969249047 4:5955275-5955297 CGGTGATTTCATCTGTAAAATGG - Intronic
970471350 4:16382238-16382260 CTGTGTCTTCACATGGCAAATGG - Intergenic
970680151 4:18497699-18497721 CTGTGAATTCATCTGGTACTGGG - Intergenic
971253526 4:24993061-24993083 CTGTTGATTCATTTGTAAAATGG + Intergenic
971259257 4:25041544-25041566 CAGTTAATTTATAAGGAAAATGG - Intergenic
971584061 4:28382187-28382209 CTGTGAATTCATATAGATCTGGG + Intronic
972824058 4:42736363-42736385 CTTTCATTTCATAGGGAAAATGG + Intergenic
972955094 4:44379148-44379170 ATGTTACTTCATATGGCAAAAGG - Intronic
972992201 4:44834530-44834552 CTGTGTCTTCACATAGAAAAAGG + Intergenic
973168396 4:47107579-47107601 CTGTTTATTCATCTGTAAAATGG + Intronic
973589722 4:52428781-52428803 CCTTGGATTTATATGGAAAATGG - Intergenic
973704101 4:53564580-53564602 ATGTCACTTCATATGGCAAAAGG + Intronic
973849750 4:54949239-54949261 ATGTGACCTCATTTGGAAAAGGG - Intergenic
974330274 4:60468936-60468958 CTGTGAATCCATATAGTCAAGGG - Intergenic
974466849 4:62268862-62268884 CTGTGAATACAAAAGGAAACAGG + Intergenic
974675813 4:65087573-65087595 CTGTGAATTCATCTGGTTCAGGG + Intergenic
974908566 4:68086902-68086924 CTGTGAATTCATCTGGTCCAGGG - Intronic
974949576 4:68571656-68571678 CTGGGAATTCATCAGGAAATGGG + Intronic
975205961 4:71644407-71644429 CTGGGAATTCATCAGGAAATGGG - Intergenic
975713929 4:77187696-77187718 CTGTGTACTCACATGGTAAAAGG - Intronic
975980825 4:80157372-80157394 ATGTGATTTTATTTGGAAAAAGG - Intergenic
976224891 4:82788096-82788118 CTGTGTCTTCACATGGCAAAAGG - Intronic
976548609 4:86367299-86367321 CTGTGAAATCATAGTGAACATGG - Intronic
977091097 4:92676568-92676590 CTGTTGATTCATATGGAGCATGG + Intronic
977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG + Intergenic
978204460 4:106063792-106063814 CTGTGTCTTCATGTGGAAGAAGG - Intronic
978367650 4:107998890-107998912 ATATGCATTCTTATGGAAAAAGG + Intronic
978913060 4:114088509-114088531 CAGTGTACTCATATGTAAAATGG - Intergenic
979831018 4:125303111-125303133 CTGTGAATTCATAAGCAAGGTGG + Intergenic
981009666 4:139912541-139912563 ATGTGACTTCATTTGGAAATAGG + Intronic
981075929 4:140591978-140592000 CTGTGAATTCATCTGGTCCAAGG + Intergenic
982098903 4:151949440-151949462 ATGTGACTTGATATGGCAAAGGG + Intergenic
982217154 4:153092244-153092266 ATGTGACCTTATATGGAAAAAGG - Intergenic
982885531 4:160775687-160775709 CAGTGAATTCAAATATAAAAAGG + Intergenic
982991565 4:162283037-162283059 ATGTGATTTCATTTGGAAATTGG - Intergenic
983433540 4:167682057-167682079 ATATGTGTTCATATGGAAAATGG + Intergenic
983969505 4:173854210-173854232 CTGTGATTTCATATTCAAATTGG + Intergenic
984719262 4:182954842-182954864 CTGTGACTTTATTTGGAAATAGG + Intergenic
984798712 4:183692098-183692120 CAGTGTATTCATCTGTAAAATGG + Intronic
985309786 4:188585297-188585319 TGGTAAATTCATATGGAAGATGG + Intergenic
985698214 5:1354176-1354198 CTGTGTATTTATATTTAAAACGG + Intergenic
986872906 5:12071284-12071306 CAGTGATTTATTATGGAAAACGG - Intergenic
988326538 5:29776005-29776027 CTGAGTCTTCATATGTAAAATGG + Intergenic
988441575 5:31239992-31240014 CTGTGAATTTTTCTGCAAAAGGG + Intronic
989585343 5:43070240-43070262 CTGTGAATTCATCTGACAACAGG + Intronic
990145206 5:52751880-52751902 CTGTGTCCTCATATGGCAAAAGG + Intergenic
990374082 5:55151895-55151917 ATGTTACTTCATATGGCAAAGGG + Intronic
990458380 5:56010912-56010934 CTTTGATTTCATCTGTAAAATGG - Intergenic
990645679 5:57841574-57841596 CTGTGTATTCAAATGTAATAAGG - Intergenic
990828551 5:59930225-59930247 ATGTGAACTTATTTGGAAAAAGG + Intronic
991607851 5:68421353-68421375 CTGTCCATTCATTTGGAAAAAGG - Intergenic
991971282 5:72144094-72144116 ATGTGACCTCATTTGGAAAAAGG - Intronic
992261205 5:74972082-74972104 CTGTGTCTTCATATGGCAGAAGG - Intergenic
992578296 5:78143643-78143665 CTGTGAATTCATAGTGTCAATGG - Intronic
992817326 5:80456503-80456525 CTGTTGATTCATATGGAAATGGG + Exonic
993015981 5:82535098-82535120 CAGTAAAGTCATATGGTAAAGGG + Intergenic
993036644 5:82766163-82766185 CTGTTAATTCATAGTGAAAATGG - Intergenic
993196492 5:84754294-84754316 GTGTGAATTCCTATGAAAAGGGG + Intergenic
993253662 5:85559564-85559586 CTGTGAATTCATCTGGTCCAGGG - Intergenic
993440791 5:87954592-87954614 CAGTGATTTCATATGCAAAATGG - Intergenic
993453863 5:88105088-88105110 CTGTGTATTCACATGGTAGAAGG - Intergenic
993884959 5:93405274-93405296 CTCTGAATCCAGCTGGAAAATGG - Intergenic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
995418543 5:111936580-111936602 ATGTGAATTTATCTGGAAATAGG - Intronic
995579431 5:113580066-113580088 CTGTGTCCTCATATGGCAAAAGG + Intronic
995871953 5:116752767-116752789 ATTTGAATTCCTAGGGAAAAGGG + Intergenic
996229077 5:121039126-121039148 TTTTGAAGTCCTATGGAAAAGGG - Intergenic
996456160 5:123684870-123684892 CTGTGAATTCACCTGGTCAAGGG - Intergenic
996500209 5:124208196-124208218 ATGTGACTGCATTTGGAAAAAGG + Intergenic
996810829 5:127514929-127514951 CTGTGAACTTATTTGGAAACAGG + Intergenic
996821508 5:127633979-127634001 CTCAGAATTCATTTGGAATAAGG - Intergenic
998574825 5:143303458-143303480 CTGTGAATCCATCTGGTCAAGGG - Intronic
999381017 5:151121573-151121595 CTGTGCCTTCATCTGGGAAATGG - Intronic
999914852 5:156247158-156247180 TTCAGAATTCATATGAAAAAGGG - Intronic
1000745437 5:165026999-165027021 ATGTGAATTGATATGGCACAGGG + Intergenic
1001658184 5:173370142-173370164 CTGTGACCTTATATGGCAAAAGG - Intergenic
1001699052 5:173693599-173693621 ATGTGACCTCATTTGGAAAAGGG + Intergenic
1002782036 6:374292-374314 CAGTGGATTCAAATGCAAAAGGG + Intergenic
1003050294 6:2774600-2774622 CTGTGACTTTATTTGGAAATAGG - Intronic
1003692060 6:8364731-8364753 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692068 6:8364779-8364801 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003699731 6:8448513-8448535 ATGTGATATCATATGGCAAAAGG - Intergenic
1003724133 6:8740268-8740290 CTGTGAATTCATCTGGTCCAGGG - Intergenic
1003804575 6:9712777-9712799 ATGTGAAATTATATGGCAAAGGG + Intronic
1003891132 6:10564686-10564708 CAGTGACTTCATCTGTAAAATGG + Intronic
1004210581 6:13638225-13638247 CAGTGTATTCATATGTAAAATGG - Intronic
1004245878 6:13974851-13974873 ATGTGAAGTCATGTGGAAAAAGG - Intronic
1004371811 6:15059342-15059364 CTGTGTCTTCATATGGCAGAAGG + Intergenic
1004470166 6:15921927-15921949 CTGTGATCTTATTTGGAAAAAGG + Intergenic
1004631791 6:17428477-17428499 CTGTGAATCTATACTGAAAATGG - Intronic
1004910906 6:20282573-20282595 CTGTGAATTCATCTCGTACAGGG - Intergenic
1005239928 6:23812496-23812518 TTGTGACTTTATATGGAAATAGG - Intergenic
1006143005 6:31942343-31942365 CTGTGACTTTATTTGGAAAAAGG - Intronic
1006721942 6:36160710-36160732 CTGTGACTTTATTTGGAAATAGG - Intergenic
1007960999 6:45959145-45959167 TTGTAAATTCAAGTGGAAAATGG + Intronic
1008205462 6:48651144-48651166 GTGCTAATTCATAGGGAAAATGG - Intergenic
1008305845 6:49899160-49899182 ATGTGACTTTATTTGGAAAAGGG + Intergenic
1008402474 6:51079600-51079622 CTGTTTCTTCATATGGAAAAGGG + Intergenic
1008835865 6:55828500-55828522 CTTTGACATCATATGTAAAATGG - Intronic
1008960818 6:57263599-57263621 ATGTGACTTCATTTGGAAACAGG - Intergenic
1009502484 6:64432447-64432469 CGGTGACTTTAAATGGAAAAAGG + Intronic
1009534014 6:64857684-64857706 TAGTAAATCCATATGGAAAATGG - Intronic
1010473300 6:76256049-76256071 CTGTGAATTCATCTGGTCCAGGG + Intergenic
1010496978 6:76545805-76545827 CTGTAATTTCACATGGCAAAAGG - Intergenic
1010582697 6:77618991-77619013 TTGGGAATCCAGATGGAAAAAGG + Intergenic
1011571199 6:88737665-88737687 CTGTGTATTCACATGGCACAAGG - Intronic
1011813976 6:91166681-91166703 CTGTGAATTTAAAAAGAAAAAGG - Intergenic
1011886745 6:92106059-92106081 CTGTGAATTCATATGGACCAGGG + Intergenic
1011946832 6:92915197-92915219 CTGTGGATTTATATCCAAAATGG - Intergenic
1012175737 6:96080657-96080679 CTGTGGATTGAAATGGAAGAAGG - Intronic
1012379451 6:98602623-98602645 CTGAGAATTCCTAAAGAAAAGGG + Intergenic
1012470196 6:99564089-99564111 CTGTTAATACAAATGGAAATTGG - Intronic
1012649828 6:101738896-101738918 CTGTGAAGTAAAATAGAAAACGG + Intronic
1013450831 6:110279190-110279212 CTGTGAGCTGCTATGGAAAAAGG + Intronic
1013916254 6:115340665-115340687 ATGTGACTTCATTTGGAAAATGG + Intergenic
1013996063 6:116309766-116309788 CTGTGTCTTCATATGGCAGAAGG + Intronic
1014698522 6:124654608-124654630 ATGTGACTTCATGTGGAAAAAGG + Intronic
1015118917 6:129680138-129680160 ATGTGAACTTATTTGGAAAAAGG - Intronic
1015363070 6:132363669-132363691 CAGTGTGTTCATATGGAAAGTGG + Intronic
1016071467 6:139744124-139744146 CTGTGCATGGATATGGAAAAGGG + Intergenic
1017123633 6:151046565-151046587 CTATGAATCCATACGAAAAATGG - Intronic
1017181140 6:151553314-151553336 CTGTGAATATATATGGAAAGAGG - Intronic
1017296471 6:152801384-152801406 CTTTGAATTCATCTGTAAAATGG - Intergenic
1017453872 6:154580126-154580148 CTTTGTGTTCATATGTAAAATGG - Intergenic
1017527991 6:155259482-155259504 CTGTCATTTCATATGCTAAAGGG + Intronic
1017896667 6:158685892-158685914 CTAGGAATTGATGTGGAAAAGGG - Intronic
1018089110 6:160330160-160330182 ATGTGATTTTATTTGGAAAATGG + Intergenic
1018234900 6:161714419-161714441 CTGTGTCTTCACATGGCAAAAGG - Intronic
1018747996 6:166777295-166777317 GTGTGAATTCATAATGACAAGGG + Intronic
1019076117 6:169389412-169389434 CAGTCAATTCATTTGGAAGAGGG - Intergenic
1019332758 7:468861-468883 CTTTGACTTCATTAGGAAAAAGG - Intergenic
1019833994 7:3362674-3362696 GTGTGAAATAATATTGAAAATGG + Intronic
1019840011 7:3431766-3431788 CTATGTCTTCATATGTAAAATGG + Intronic
1020575974 7:9929020-9929042 CTGTGACCTTATTTGGAAAAAGG - Intergenic
1020716760 7:11683753-11683775 CTATGAATTCATCTGGTACAGGG - Intronic
1021223761 7:18004574-18004596 CAGTGCCTTCTTATGGAAAAAGG - Intergenic
1021412795 7:20347057-20347079 CTGTGTCTTCATATGGCAGAAGG - Intronic
1021541881 7:21768797-21768819 CTGTAAATTCATTTTTAAAATGG + Intronic
1022155759 7:27661023-27661045 TTGTGAATTCATGTGAAAACTGG + Intronic
1022400554 7:30032491-30032513 CAGTGTCTTCATCTGGAAAATGG - Intronic
1022495643 7:30851336-30851358 CTGTTTACTCATCTGGAAAATGG + Intronic
1022892864 7:34718822-34718844 CTGAGACTTCATTTGTAAAATGG + Intronic
1023058115 7:36305703-36305725 CAGTGGATTCAGATGGAAACTGG + Intergenic
1024746512 7:52413188-52413210 CTATGAAGTCATATGGCAAAGGG - Intergenic
1024755281 7:52522147-52522169 CTGTGACCTCACATGGCAAAGGG + Intergenic
1025727360 7:64079043-64079065 AAGAGAATTCATATGGAAGAGGG + Intronic
1026051197 7:66948120-66948142 CTGTTTGTTCATATGTAAAAGGG + Intronic
1028339429 7:89700301-89700323 CAGTGAATTCATTTTGACAAAGG + Intergenic
1028603349 7:92627467-92627489 CTGTGTCTTCATATGGTGAAAGG - Intronic
1030341378 7:108384425-108384447 CTTCAAATTCATATGGAAATAGG - Intronic
1030991867 7:116310642-116310664 ATGTGACTTTATTTGGAAAAAGG - Intronic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1031340116 7:120589803-120589825 CAGTTTATTCCTATGGAAAATGG + Intronic
1031419802 7:121537856-121537878 CTGTGAATACATATGGTGCATGG + Intergenic
1031504685 7:122567338-122567360 CTTTTAATTTATATGAAAAAAGG + Intronic
1031661617 7:124432466-124432488 CTGCAAAGTCATGTGGAAAAGGG + Intergenic
1031788819 7:126072956-126072978 CTGTGAGCTCATATGGCACAAGG + Intergenic
1031819225 7:126478114-126478136 ATGTGATCTTATATGGAAAAGGG - Intronic
1032440499 7:131939218-131939240 ATGTGAATTTATTTGGAAATAGG - Intergenic
1032884822 7:136125862-136125884 CTCTGAATTCATCAGGAAATGGG + Intergenic
1035490064 7:159267913-159267935 CTGGTAATTCATAAAGAAAAAGG + Intergenic
1035899325 8:3440937-3440959 CTGTGATTTTATTTGGAAAATGG + Intronic
1036051350 8:5202073-5202095 ATGTGATCTCATTTGGAAAAAGG + Intergenic
1037524386 8:19710368-19710390 CAGTGAAATCATCTGAAAAAAGG + Intronic
1039144354 8:34429537-34429559 CTTTGGTTTCACATGGAAAAAGG - Intergenic
1039398110 8:37244663-37244685 CTGTGGAATCACATGGTAAAGGG + Intergenic
1040678449 8:49780649-49780671 CTGTGTACACATATGGCAAAAGG + Intergenic
1040706408 8:50133819-50133841 ATGTAAACTCATTTGGAAAAGGG - Intronic
1040824082 8:51598848-51598870 CTGTGAATCCATTTGGTACAAGG + Intronic
1041206416 8:55502916-55502938 CTGGGAAAACATATGCAAAAAGG - Intronic
1041676301 8:60543560-60543582 ATGTGACTTTATTTGGAAAAAGG - Intronic
1041949392 8:63484255-63484277 CTGTGAATTCATCTGGTACAGGG + Intergenic
1042020297 8:64366530-64366552 CAGTGAATTTGTATGGAAATTGG - Intergenic
1042115069 8:65422440-65422462 CTGTGACCTTATATGGAAATAGG + Intergenic
1042156697 8:65851699-65851721 ATGTGAACTTATTTGGAAAAAGG + Intergenic
1042693526 8:71530070-71530092 CTGTGACTTTATTTGGAAATAGG + Intronic
1042817214 8:72890675-72890697 CAGTGATTTCATCTGGAAAACGG - Intronic
1042851880 8:73225062-73225084 ATGTGAACTTATTTGGAAAAAGG - Intergenic
1043696018 8:83218613-83218635 CTGAGAATTCATATGGTCCAGGG + Intergenic
1044051064 8:87504902-87504924 ATGTAAGTCCATATGGAAAAAGG + Intronic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1045348496 8:101316426-101316448 ATGTGAACTCATTTGGAAATAGG + Intergenic
1045611999 8:103854969-103854991 CTGTGAATTCATCTGGTCCAGGG + Intronic
1045858994 8:106794616-106794638 ATGTGACTTCATTTGGAAAAAGG - Intergenic
1045981578 8:108195459-108195481 CTGTGAACTCATGTAGAGAAGGG + Intergenic
1046186858 8:110733664-110733686 CTGAGAGTTTATATGGGAAAGGG - Intergenic
1046451583 8:114398742-114398764 CTGTGAATCCATCTGGTCAAGGG + Intergenic
1046679796 8:117155999-117156021 CTGTGACTTTATTTGGAAATAGG - Intronic
1046680072 8:117158885-117158907 ATGTTAAATCATATGGCAAAAGG + Intronic
1047459343 8:125047387-125047409 TTGTAAAATTATATGGAAAAGGG - Intronic
1047494105 8:125397484-125397506 CTGTGACCTTATATGGACAAAGG - Intergenic
1047521907 8:125601472-125601494 CAGTGAAGTCATCTGGACAATGG - Intergenic
1048184875 8:132230494-132230516 CTGTGACTTAATATGGTAAGAGG - Intronic
1048367076 8:133747376-133747398 CTGTGTTTTCATATGGCAGAAGG - Intergenic
1048590458 8:135816449-135816471 CTGTGACCTTATTTGGAAAAAGG + Intergenic
1048746868 8:137624323-137624345 CTGTGATCTCATTTGGAAAAGGG - Intergenic
1049244887 8:141557164-141557186 ATGTGAATTTATTTGGAAATAGG - Intergenic
1049537914 8:143190536-143190558 ATGTGAGCTCATTTGGAAAAAGG - Intergenic
1050164759 9:2753365-2753387 CTGTGAATTCATCTGGTCTAGGG - Intronic
1051302700 9:15670071-15670093 CTCTGAATTCTGATGGGAAAGGG - Intronic
1052391258 9:27881166-27881188 ATGTTAATTCTTATGCAAAATGG + Intergenic
1053348524 9:37395740-37395762 TTGTGAATTCAGGTGGGAAAAGG + Intergenic
1053934946 9:43140916-43140938 CTATGAATCCAAATGAAAAATGG - Intergenic
1054869960 9:70040073-70040095 ATGTGACCTCATTTGGAAAAAGG - Intergenic
1055246660 9:74253401-74253423 CTAGGAATTCACATGGCAAAAGG - Intergenic
1055320173 9:75075932-75075954 CTGTGATTCCATGTGGAGAAAGG + Intronic
1055342786 9:75302826-75302848 CTGTGAATTCATCTGGTCCAGGG + Intergenic
1055538589 9:77276940-77276962 ATGTTAACTCATATGGCAAAAGG - Intronic
1057843628 9:98505562-98505584 ATGTGACCTCATTTGGAAAAAGG + Intronic
1057860127 9:98634352-98634374 ATGTGACTTCATTTGGAAATAGG + Intronic
1058091631 9:100812554-100812576 ATGTGATTTTATATGGCAAAAGG + Intergenic
1058206194 9:102111368-102111390 CTGTGAATTCACATGGTTCAGGG + Intergenic
1059187317 9:112286188-112286210 CTGAGATTTCATATTTAAAATGG + Intronic
1059701180 9:116776556-116776578 CTGTGATTCTATATGTAAAATGG + Intronic
1059716806 9:116920779-116920801 CAGTGTATTCATCTGTAAAATGG - Intronic
1059727011 9:117018787-117018809 CATTGAATGCACATGGAAAATGG + Intronic
1059807601 9:117820158-117820180 CTGTGAATCCATCTGGTCAAGGG + Intergenic
1060806658 9:126581918-126581940 ATGTGACTTCATTTGGAAATAGG + Intergenic
1061323585 9:129848371-129848393 CTGTGTCTTCATCTGTAAAATGG + Intronic
1061637171 9:131919566-131919588 CTGTTTTTTCATTTGGAAAATGG + Intronic
1061703758 9:132436421-132436443 ATGTGACCTCATTTGGAAAAAGG - Intronic
1061909910 9:133716983-133717005 CTGTGTTTTCATCTGTAAAATGG - Intronic
1186030670 X:5365910-5365932 TTGTGACTGCATATGGAACAGGG - Intergenic
1186083698 X:5962785-5962807 CTGTGTCCTCACATGGAAAAAGG - Intronic
1186112014 X:6267754-6267776 ATGTGACTTCATTTGGAAATAGG - Intergenic
1186257328 X:7736691-7736713 CTGTGTTTTCACATGGCAAAAGG + Intergenic
1186768584 X:12795255-12795277 ATGTGAGTTTATATGGCAAAGGG - Intronic
1187161798 X:16772188-16772210 CTGTGATTTCTTTTGGATAAAGG + Intergenic
1187341150 X:18422830-18422852 CTGTTTCTTCATCTGGAAAATGG + Intergenic
1187614589 X:20979661-20979683 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1187889153 X:23917384-23917406 ATGAGAATTCATGTGAAAAAAGG - Intronic
1187934822 X:24325661-24325683 CTGTAAAGTCATATAGGAAATGG + Intergenic
1188027842 X:25229553-25229575 ATGTGACTTCATTTGGAAATAGG + Intergenic
1188538042 X:31219167-31219189 CTGTGAACGCATATGGAAACTGG - Intronic
1188806669 X:34599056-34599078 CTGTGAATCCATCTGGTAAAGGG + Intergenic
1188989320 X:36798560-36798582 CTGTGTCCTCATATGGCAAAAGG - Intergenic
1189258274 X:39657499-39657521 CTGTGAATACAAATGGGAACAGG + Intergenic
1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG + Intergenic
1189347410 X:40252541-40252563 TTGTTAATTCATTTGTAAAATGG + Intergenic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1189563322 X:42213678-42213700 ATGTGACTTCATTTGGAAACAGG - Intergenic
1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG + Intergenic
1189608806 X:42709079-42709101 CTATGTCTTCATATGTAAAATGG + Intergenic
1189694289 X:43647756-43647778 CTGTGAACTGGTATGGAATATGG - Intergenic
1190324050 X:49195854-49195876 CTGTTTATTCATCTGTAAAAAGG - Intronic
1190524874 X:51318771-51318793 CTGTGTATTCACTTTGAAAAAGG - Intergenic
1191017284 X:55822623-55822645 CTGTGAATTCATTTGGTCCAGGG + Intergenic
1191313242 X:59095428-59095450 CTGTGGATTTCTTTGGAAAAGGG + Intergenic
1192928437 X:75780431-75780453 TTGTGAACTCATTTGGAAGATGG - Intergenic
1193583993 X:83298313-83298335 CTGTGAATTCATCTGGACCTGGG - Intergenic
1193828473 X:86257401-86257423 CTGACAGATCATATGGAAAAGGG + Intronic
1193961530 X:87931142-87931164 CTGCGAAGTCACATTGAAAAGGG - Intergenic
1194040502 X:88936314-88936336 CTATGAATTCATATGGTTCAGGG + Intergenic
1194047374 X:89024845-89024867 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1194346927 X:92776915-92776937 CTGTGAATCCATATGGTACTGGG - Intergenic
1194764391 X:97832533-97832555 CTGTGACTTCACATGGCAGAAGG + Intergenic
1194805501 X:98322083-98322105 CTGTGAATTCATGTGGTCCAGGG - Intergenic
1194979097 X:100422489-100422511 CTGTGTATTCACATGGTAGAAGG - Intergenic
1195003306 X:100663114-100663136 CTGAGCATTCATATAGAAATGGG + Intronic
1195762966 X:108266845-108266867 CTGTGAGTACATTTGGAATAGGG + Intronic
1196577203 X:117333157-117333179 CTGTGTCTTCACATGGTAAAAGG - Intergenic
1198036243 X:132804143-132804165 CAGTGAATAAATATGGCAAAAGG + Intronic
1198169022 X:134086954-134086976 CTGTGAATCCATCTGGTCAAGGG - Intergenic
1200032880 X:153310701-153310723 CTGTGAGGTCACATGGCAAAAGG - Intergenic
1200458771 Y:3427544-3427566 CTGTGACTTCACATAGTAAAAGG - Intergenic
1200737044 Y:6811240-6811262 CTGTGTATCCACATGGTAAACGG + Intergenic
1200922790 Y:8628116-8628138 CTGCGACTTCACATGCAAAAAGG + Intergenic
1201620622 Y:15953096-15953118 ATGGGAACTTATATGGAAAAGGG + Intergenic
1201866080 Y:18656906-18656928 ATGTGACCTCATTTGGAAAAAGG + Intergenic
1201912878 Y:19151352-19151374 CTGTGACTTCACATGGTAGAAGG + Intergenic
1202117512 Y:21484395-21484417 CTCTAATTTCATCTGGAAAATGG - Intergenic