ID: 1070377767

View in Genome Browser
Species Human (GRCh38)
Location 10:75850531-75850553
Sequence TTGCTCATATAACACCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070377764_1070377767 18 Left 1070377764 10:75850490-75850512 CCCAAGAATTACTGGGTGGGTAA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1070377767 10:75850531-75850553 TTGCTCATATAACACCATCTGGG No data
1070377765_1070377767 17 Left 1070377765 10:75850491-75850513 CCAAGAATTACTGGGTGGGTAAG 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1070377767 10:75850531-75850553 TTGCTCATATAACACCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070377767 Original CRISPR TTGCTCATATAACACCATCT GGG Intronic
No off target data available for this crispr