ID: 1070378540

View in Genome Browser
Species Human (GRCh38)
Location 10:75858150-75858172
Sequence CACTGCTGGTGGGCTGGTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070378540_1070378553 20 Left 1070378540 10:75858150-75858172 CCCGTACCAGCCCACCAGCAGTG 0: 1
1: 0
2: 6
3: 27
4: 202
Right 1070378553 10:75858193-75858215 CAGTAGAAGCAGGTACCACATGG No data
1070378540_1070378552 10 Left 1070378540 10:75858150-75858172 CCCGTACCAGCCCACCAGCAGTG 0: 1
1: 0
2: 6
3: 27
4: 202
Right 1070378552 10:75858183-75858205 TCTGTCTACTCAGTAGAAGCAGG No data
1070378540_1070378554 21 Left 1070378540 10:75858150-75858172 CCCGTACCAGCCCACCAGCAGTG 0: 1
1: 0
2: 6
3: 27
4: 202
Right 1070378554 10:75858194-75858216 AGTAGAAGCAGGTACCACATGGG No data
1070378540_1070378555 22 Left 1070378540 10:75858150-75858172 CCCGTACCAGCCCACCAGCAGTG 0: 1
1: 0
2: 6
3: 27
4: 202
Right 1070378555 10:75858195-75858217 GTAGAAGCAGGTACCACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070378540 Original CRISPR CACTGCTGGTGGGCTGGTAC GGG (reversed) Intronic
901226343 1:7614893-7614915 TACTGCTGGGGGGAGGGTACAGG + Intronic
901720482 1:11193405-11193427 CACTGCTGGTGAGCTGGGGTGGG - Intronic
903340997 1:22654199-22654221 CAATGATGATGGGCTGGCACAGG + Intronic
903449754 1:23444901-23444923 CACAGCTGGGGGGATGCTACTGG - Intronic
904006149 1:27364286-27364308 CCTGGCTGATGGGCTGGTACAGG - Exonic
904265535 1:29316672-29316694 CACTGCTGGCGGCCAGGTGCAGG - Intronic
905935411 1:41820052-41820074 AACAGGTGGTGGGCTGGAACTGG + Intronic
907343186 1:53752159-53752181 CACTGCTGGTGGAATGGTTGTGG - Intergenic
908093005 1:60706596-60706618 CACTGCTGGGGGGCTGGCGAAGG - Intergenic
908655142 1:66380568-66380590 CAATGCTGGTGAGGTGGCACAGG + Intergenic
913662149 1:121013535-121013557 CACTGGCCGTGGGCTGGTTCTGG + Intergenic
913959247 1:143326625-143326647 CACTGTGGGTGGCCTGGGACGGG - Intergenic
914053564 1:144152005-144152027 CACTGTGGGTGGCCTGGGACGGG - Intergenic
914125633 1:144814536-144814558 CACTGTGGGTGGCCTGGGACGGG + Intergenic
914459768 1:147872620-147872642 CAGTGGTGGAGGGCTGGGACAGG - Intergenic
915978815 1:160407799-160407821 CTCACCTGGTGGGCAGGTACGGG + Intronic
922246444 1:223803050-223803072 CACAGCTGGTGGTCTTGCACAGG - Intronic
923819019 1:237415018-237415040 CACAGCTGGTGGGAGGCTACTGG + Intronic
923858180 1:237866935-237866957 CTTTGCTGGGGGGCTGGTAGTGG + Intergenic
924949261 1:248867461-248867483 CACTGGTGCTGGCCTGGTGCTGG - Intergenic
1064558152 10:16568194-16568216 CTCAGGTGGTGGACTGGTACCGG + Intergenic
1067943042 10:50672075-50672097 TGTTGCTGGTGGGCTGGTTCAGG - Intergenic
1068071925 10:52206719-52206741 TAATGCTAGAGGGCTGGTACTGG + Intronic
1068444928 10:57108702-57108724 CACTGCTGCTGGGAAGGAACAGG - Intergenic
1070378540 10:75858150-75858172 CACTGCTGGTGGGCTGGTACGGG - Intronic
1070864286 10:79697036-79697058 TGTTGCTGGTGGGCTGGTTCAGG - Intergenic
1070884111 10:79874773-79874795 CAGGGCTGGTGGGGTGGGACAGG - Intergenic
1071631185 10:87219263-87219285 TGTTGCTGGTGGGCTGGTTCAGG - Intergenic
1071650665 10:87391073-87391095 CAGGGCTGGTGGGGTGGGACAGG - Intergenic
1073117588 10:101100431-101100453 GAGTGCTGATGGGCTGGTGCCGG - Intronic
1073932821 10:108595796-108595818 CACTGGAGGTGGACAGGTACAGG - Intergenic
1075912896 10:126141190-126141212 CACAGCTGGCTGGCTGGTAAGGG - Intronic
1076301422 10:129430404-129430426 CAGTCCTGGTGAGGTGGTACAGG + Intergenic
1078209822 11:9261821-9261843 CATTTCTGGTGGGTTGGTAGGGG - Intronic
1083440435 11:62672455-62672477 CTCTTCTGGTGGGGTGGGACAGG - Exonic
1083632135 11:64101245-64101267 CACGGCTGGTGGGCTGGGCAGGG + Intronic
1083668611 11:64288422-64288444 CCCTGCTGGTGGGCTTCTTCCGG + Exonic
1083668899 11:64289616-64289638 CAAGGCTGGTGGGCTGGGAGAGG + Intergenic
1084701002 11:70786002-70786024 CACTGCTAGAGGTCTGGTCCCGG - Intronic
1084738099 11:71118912-71118934 CATTGCTGGCCGGCTGGAACAGG + Intronic
1085926925 11:81034365-81034387 CACAGCTGGGGGACTTGTACAGG + Intergenic
1087122195 11:94586698-94586720 CACAGCTGGGAGGCTGCTACTGG + Intronic
1088166935 11:106950341-106950363 TACTGCTGCTGGGCTGCTGCTGG - Intronic
1089191421 11:116656251-116656273 CTCAGCTGGAGGGCTGGTAGAGG - Intergenic
1089682280 11:120125347-120125369 CACAGCTGCTGGGCTGGGCCCGG + Intronic
1090382871 11:126339015-126339037 CTCTGGTGGTGGGCTGGTCTGGG - Intronic
1090957288 11:131524811-131524833 CCCTGCTGTGGGGCTGGTCCCGG - Intronic
1093561785 12:20551661-20551683 CACTGCTGAGGGGCGGGTCCAGG - Intronic
1096397172 12:51275081-51275103 AACTGCTGGAGGGCAGGGACTGG + Intergenic
1096560788 12:52434332-52434354 CACCTGAGGTGGGCTGGTACAGG + Exonic
1098381534 12:69875552-69875574 CCCTGCCGGTGGACTGCTACGGG + Intronic
1099790760 12:87330532-87330554 TCCTCCTGGTGGGCTAGTACGGG - Intergenic
1102144496 12:110644721-110644743 AACTGCTGGTGGGCTGGGTGTGG + Intronic
1105806303 13:23953512-23953534 CACTGCTGGTGGTGTGGTGGTGG - Intergenic
1108703721 13:52966049-52966071 CACTGAGGGTGCGCTGGTTCTGG - Intergenic
1108958212 13:56187552-56187574 CAGTGCTTGTGGGCTGGCGCGGG + Intergenic
1113068790 13:106397817-106397839 CACTGCTGGAATGCTGGTGCTGG - Intergenic
1114968467 14:27995769-27995791 CACTGCTGTTGGCCTGGCCCTGG - Intergenic
1115242342 14:31261958-31261980 CACTGCTGGCTGGCTCGCACAGG + Intergenic
1116887238 14:50232766-50232788 CACTGCTGGTGGCTAGGGACAGG - Intergenic
1117667951 14:58076960-58076982 CACTGCTGCTGGCCGGGTAGAGG - Intronic
1118777529 14:68982396-68982418 CACAGCTGGTGGGTTCCTACTGG + Intergenic
1120621568 14:86771947-86771969 CACTGGTGGAGGGCTGCTCCTGG + Intergenic
1122790634 14:104182840-104182862 CCCTGCAGGTGAGCAGGTACAGG - Intergenic
1202929178 14_KI270725v1_random:23562-23584 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1123423120 15:20147658-20147680 CACTGCGGGTGGCCTGGGACGGG - Intergenic
1123532345 15:21154197-21154219 CACTGCGGGTGGCCTGGGACGGG - Intergenic
1124031911 15:26019491-26019513 CACTGCTGGAAGGCTGGTGGTGG + Intergenic
1125728531 15:41880394-41880416 CTCTGCTGGTGGGCTGGGATGGG - Intronic
1125873415 15:43123055-43123077 CGATGCTGGTGAGCTGGAACTGG - Intronic
1128533274 15:68469656-68469678 CACTGCTGGCAGGCTGGTTTGGG + Intergenic
1132603125 16:782692-782714 CCCTGCGGGTGGGCTGGTGGTGG + Intronic
1134620635 16:15686446-15686468 CAGGGCAGCTGGGCTGGTACTGG + Intronic
1136576761 16:31129926-31129948 CACTTCGCGTGGGCTGGTGCCGG + Intronic
1136861633 16:33707685-33707707 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1138541423 16:57689954-57689976 AACTGCTTGTGGGCTGGGAGGGG - Intergenic
1139199099 16:64954578-64954600 CAGGGCTGGTGAGCTGGTAAAGG + Intronic
1142334998 16:89482678-89482700 CACTGCTGGGGGGCTGAGGCGGG + Intronic
1203123129 16_KI270728v1_random:1555869-1555891 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1143891787 17:10107744-10107766 CACTGGTGGTGAGCTGGTTAGGG + Intronic
1143891825 17:10107905-10107927 CAGTGGTGGTGGGCTGGTTAGGG + Intronic
1144686926 17:17232239-17232261 CTCTTCTGGTGGGCTGGCAAGGG - Intronic
1144955107 17:19015184-19015206 TCCTGCTGGTGGGACGGTACGGG + Exonic
1145207261 17:20991194-20991216 CACTGCTGGGAGGCTGGGAAAGG + Intergenic
1148127214 17:45243006-45243028 CTCTGCTGGTGGCCTGGTCAGGG + Intronic
1149127723 17:53255269-53255291 TAATTCTGGGGGGCTGGTACTGG - Intergenic
1149951913 17:60997257-60997279 CCCAGGTGGTGGACTGGTACCGG - Intronic
1151973630 17:77471781-77471803 CATGGCTGGAGGGCTGGCACGGG + Intronic
1152091554 17:78250381-78250403 CTCTGCTGTTGGGCTGGTGCAGG + Intergenic
1152162284 17:78676270-78676292 CAGTGATGGTGGGGTGGGACAGG - Intronic
1153433976 18:5048998-5049020 CACTGGTTGTGGGCTGCTCCAGG - Intergenic
1154502664 18:15004422-15004444 CACTGCTGGGGAGCTGGGGCAGG + Intergenic
1155109138 18:22696860-22696882 GACTGCTGGTGGTCTGGTCCTGG + Intergenic
1156030628 18:32708263-32708285 CACCTCTGGTGGGATGGTGCTGG - Intronic
1156579356 18:38357057-38357079 CATTGGTGGTGGTGTGGTACGGG - Intergenic
1158829827 18:61264507-61264529 AACTGGTTCTGGGCTGGTACTGG - Intergenic
1160374267 18:78399478-78399500 CACAGCTGGTGGGGAGGTGCTGG + Intergenic
1161008338 19:1947695-1947717 GCCTGCAGGTGGGCTGGGACAGG + Intronic
1161555789 19:4941890-4941912 CACTGCTGAGGGGCGGGTCCAGG - Exonic
1161703815 19:5808519-5808541 CACAGCTGGGTGGCGGGTACAGG + Intergenic
1165917642 19:39270364-39270386 CATTGCTGCTGGGCTCTTACTGG + Intergenic
1166583497 19:43924724-43924746 CAGTACTGGTGGGCTGGTTCTGG - Intronic
1166626278 19:44358948-44358970 TACTGCTGGTTGGCAGGCACAGG - Intronic
1202692961 1_KI270712v1_random:104426-104448 CACTGTGGGTGGCCTGGGACGGG - Intergenic
925158772 2:1667039-1667061 CCCTGCAGGTGGGCTGGGCCAGG - Intronic
927071699 2:19537063-19537085 CATTGCTGGTGAGCTGGTATGGG - Intergenic
927825857 2:26309884-26309906 CACTGGTGGGGAGCTGGAACCGG + Intronic
928400282 2:30972851-30972873 AACCGCTGGTGGGCTGCCACGGG + Intronic
933604185 2:84364081-84364103 CACTGCTGGTGGGAATGTAATGG + Intergenic
933953437 2:87349536-87349558 CACTGTGGGTGGCCTGGGACGGG + Intergenic
934237643 2:90245785-90245807 CACTGTGGGTGGCCTGGGACGGG + Intergenic
934275557 2:91570945-91570967 CACTGTGGGTGGCCTGGGACGGG - Intergenic
934460082 2:94209124-94209146 CACTGCTGGTGGCCTGGGACGGG + Intergenic
934996618 2:98967454-98967476 GGGTGCTGGTGGGCTGGGACTGG + Intergenic
938801168 2:134764722-134764744 CACTGATGGTGGACTGGTTCTGG + Intergenic
939218432 2:139271292-139271314 CACAGCGGGAGGACTGGTACTGG - Intergenic
939252374 2:139698407-139698429 CACTGCTCCTGGGCTGCTCCAGG - Intergenic
941168089 2:162104839-162104861 CACAGCTGGTGGGTTGTTGCTGG - Intergenic
941198148 2:162475735-162475757 CACTGCTGGTGGGTGGGTGGGGG - Intronic
941656520 2:168150521-168150543 CACTGCAGGTGTGATGGTACTGG + Intronic
947993858 2:234510847-234510869 CACTTCTGGTGGGATTGTAATGG - Intergenic
948455745 2:238103875-238103897 GGCTGCTAGGGGGCTGGTACTGG + Intronic
948980413 2:241491615-241491637 CAATGCACGTGTGCTGGTACCGG + Exonic
1170983539 20:21237792-21237814 CACTGCGGGAGGGAGGGTACTGG - Intronic
1173247683 20:41347744-41347766 CTCTGCTGGTGGGGTGCTCCCGG - Intronic
1173929723 20:46808354-46808376 CACTGCAGGTTGGCAGGTAAGGG + Intergenic
1176515508 21:7780670-7780692 CAAGGCTGGTGGGCAGGTACAGG + Intergenic
1176591202 21:8652160-8652182 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1177703890 21:24674853-24674875 CAGTGCAGGTGGGCAGGTGCAGG - Intergenic
1178649536 21:34410682-34410704 CAAGGCTGGTGGGCAGGTACAGG + Intergenic
1179957527 21:44749807-44749829 CACTCCTTCTGGGCTGGTCCAGG + Intergenic
1180094009 21:45546340-45546362 CACTGCTGTGGGGCTGTGACAGG - Intergenic
1180274048 22:10629271-10629293 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1181356183 22:22297638-22297660 CACTGCGGGTGGCCTGGGACCGG - Intergenic
1181456872 22:23064773-23064795 CACAGCTGGGGTGCAGGTACTGG + Intronic
1182143384 22:27982000-27982022 GACTTCTGTGGGGCTGGTACAGG - Exonic
1182277730 22:29201082-29201104 CAGGGCTGGTGGGCTGCTCCAGG + Intergenic
1182766151 22:32759894-32759916 GGCTGCTGGTGGGTGGGTACTGG - Intronic
1182908102 22:33956245-33956267 CAGTGCTAGTGGTCTTGTACGGG - Intergenic
1183844605 22:40531070-40531092 CACTGCTGGTGGTCTCTTACTGG - Intronic
1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG + Intergenic
950497013 3:13339937-13339959 GAGCGCTGCTGGGCTGGTACAGG - Exonic
952253799 3:31678449-31678471 CACCGCTGGTGGTCGGGGACAGG + Intronic
954496791 3:50972164-50972186 CACTGCAGGTATGCTGCTACTGG + Intronic
957215775 3:77317777-77317799 CGCTGCTGGGGGGCTGCTAGGGG + Intronic
957215829 3:77317902-77317924 CGCTGCTGGGGGGCTGCTAGGGG + Intronic
961413017 3:126736719-126736741 CACTGGTGGTGCCCTGGTTCTGG + Intronic
961723047 3:128908675-128908697 CACTGCTGGAGGCCAAGTACAGG + Intronic
962464134 3:135641128-135641150 CAGTGATGGTGGACTGGTCCTGG - Intergenic
963725171 3:148911789-148911811 CACTGCTGTTGGGCTTGGTCAGG + Intergenic
966875143 3:184317335-184317357 CACTGCTCGGGGGCTGGGCCCGG - Exonic
968087461 3:195880401-195880423 CATTGCTGGGGGGGTGTTACAGG - Intronic
968087511 3:195880609-195880631 CATTGCTGGGGGGGTGTTACAGG - Intronic
968087530 3:195880710-195880732 CATTGCTGGGGGGGTGTTACAGG - Intronic
968087585 3:195880915-195880937 CATTGCTGGGGGGGTGTTACAGG - Intronic
968087622 3:195881069-195881091 CACTGCTGGGGGGGTGTTAGAGG - Intronic
968087635 3:195881119-195881141 CACTGCTGGGGGGGTGTTACAGG - Intronic
968087648 3:195881169-195881191 CATTGCTGGGGGGGTGTTACAGG - Intronic
968087685 3:195881323-195881345 CACTGCTGGGGGGGTGTTAGAGG - Intronic
968087698 3:195881373-195881395 CACTGCTGGGGGGGTGTTACAGG - Intronic
968123828 3:196144172-196144194 CAATGCTGGGGGGCTGGTCTGGG - Intergenic
968907803 4:3462736-3462758 CAGTGCAGGTGGGCGGGTCCAGG - Intergenic
969255590 4:5999633-5999655 CACAGCTGGTGGCCAGGGACTGG + Intergenic
969366355 4:6696804-6696826 CACTGCTGCTGGGCAGGAGCAGG - Intronic
969451014 4:7273413-7273435 CATTGCTGGAGGGCTGCTTCTGG + Intronic
969471647 4:7392650-7392672 CAGGGCTGCTGGGCTGGTCCTGG + Intronic
975156813 4:71081437-71081459 CACTGCAGCTGTGCTGGTGCTGG + Intergenic
975243887 4:72095235-72095257 GTCTGCTGGTGTGCTGGAACTGG + Intronic
981032948 4:140144161-140144183 CACAGCTGGAGGGCTGCTACAGG - Intronic
984102306 4:175500068-175500090 CACTGCTGTGGGGCTGGCACTGG - Intergenic
984166839 4:176312945-176312967 CCCTGCTGGTGGGTTGGTCTTGG - Intergenic
986825786 5:11520708-11520730 GACAGGTGATGGGCTGGTACTGG - Intronic
987749971 5:22026855-22026877 CTCTGCTGGTAGGCCAGTACAGG - Intronic
990962343 5:61407892-61407914 CACTGCTGGTGGGAGGGTAAAGG + Intronic
993144021 5:84070996-84071018 CACTGGCAGTGGGCTGGAACTGG - Intronic
994993072 5:107022524-107022546 CACTGATTCTGGGCTGATACTGG - Intergenic
995254299 5:110028904-110028926 CACGTCTGATGGGCTGGTAGGGG + Intergenic
996097272 5:119411964-119411986 CACTGCTGGTAGTTTGGTATTGG + Intergenic
1001037953 5:168311355-168311377 CCCTGCTGCTGGGCAGGTGCGGG + Intronic
1003173576 6:3738527-3738549 CACTGGGGGTGGGCTGGTCCTGG - Intronic
1003427824 6:6009020-6009042 CGCAGCTGGTGGCCTGGTCCGGG - Intergenic
1007358258 6:41336154-41336176 GACTGCCCGTGGGCGGGTACTGG - Exonic
1009687938 6:66987345-66987367 CACTGCTGGGGGACTGGGAAGGG + Intergenic
1009998331 6:70921895-70921917 TAACGCTGATGGGCTGGTACTGG + Intronic
1012473818 6:99600170-99600192 CACTGGTGGTTGCCTGGAACTGG + Intergenic
1013198151 6:107864122-107864144 CACTGCTGGTGAACTGGAGCTGG - Intergenic
1015235613 6:130967493-130967515 CTCTGCTGGAGGGCTGGGAATGG + Intronic
1015371500 6:132459114-132459136 CAGGCCTGGTGGGCTGGCACAGG + Exonic
1017499144 6:155007066-155007088 CACTGCGGCTGGTCTGCTACTGG + Intronic
1017947363 6:159106556-159106578 CCGTGCTGGTGGGCTGGGCCAGG + Intergenic
1018187665 6:161280991-161281013 CACTGCTCCTGGGTTAGTACAGG + Intergenic
1019921962 7:4168905-4168927 CACTGGTGGTGGGGTGGGAGTGG - Intronic
1021989877 7:26130864-26130886 CACAGCTAGTGGACTGGTCCTGG + Intergenic
1022892427 7:34714912-34714934 CACTGCTGCTGGGCTGAGATGGG - Intronic
1024670251 7:51587756-51587778 CACAGCTGGTGTGCTAGTGCAGG - Intergenic
1028292080 7:89077163-89077185 AACTGCTGTAGGGCAGGTACAGG + Intronic
1029597839 7:101547087-101547109 CAGTGCTGGGAGGCTGGTCCGGG - Intronic
1029623859 7:101707413-101707435 CAGTGCTGGGGGGCTGGTCATGG - Intergenic
1031547438 7:123068019-123068041 CAGTGGTGGTGGGGTGGTAATGG + Intergenic
1032785382 7:135196129-135196151 CACTGCAGGTGGGTTGGGCCTGG - Exonic
1036721572 8:11180442-11180464 CACAGCTGGAGGGGTGCTACTGG - Intronic
1037333519 8:17768743-17768765 CTCTGCTGGTGGTCTTGTAATGG - Intronic
1037696300 8:21227208-21227230 TACTGATGCTGGGCTGGTCCTGG - Intergenic
1037758097 8:21724322-21724344 CATTGCTGGGGGGTTGGTGCGGG + Intronic
1037987653 8:23299750-23299772 CACAGCAGGGGGGCGGGTACAGG + Intronic
1041034648 8:53776080-53776102 CAGCGCCGGTGGGCTGGCACCGG + Intronic
1042031863 8:64485021-64485043 CAATGCTTGTGGGCTGGTGGAGG + Intergenic
1045986585 8:108256348-108256370 AACTCCTTGTGGGCTGGGACTGG - Intronic
1048948150 8:139469785-139469807 CATTGCAGGTGGGTGGGTACAGG - Intergenic
1049260381 8:141635874-141635896 CACTGCAGTTGGGGTGCTACTGG + Intergenic
1049685904 8:143939240-143939262 CACCGCTGGGGGGCTGGTCTTGG - Intronic
1052968400 9:34360668-34360690 CAATGCAGGTGGGTTGGTAAGGG - Intergenic
1054274240 9:63052692-63052714 CACTGCTGGTGGCCTGGGACGGG - Intergenic
1054301832 9:63385774-63385796 CACTGCTGGTGGCCTGGGACGGG + Intergenic
1054400601 9:64712277-64712299 CACTGCTGGTGGCCTGGGACGGG + Intergenic
1054434207 9:65196592-65196614 CACTGCTGGTGGCCTGGGACGGG + Intergenic
1054496182 9:65825088-65825110 CACTGCTGGTGGCCTGGGACGGG - Intergenic
1056574303 9:87843264-87843286 CAGGGCTGGTGGGGTGGGACAGG + Intergenic
1057125699 9:92614281-92614303 CACTGTTGCTGGGCTGGGGCTGG - Exonic
1057833137 9:98422337-98422359 CACTTCTGGTGGGATGTCACAGG + Intronic
1060943559 9:127557162-127557184 CACTCCTGGTAGGCTGGATCAGG - Intronic
1060989821 9:127842071-127842093 AACTGATGGTGGGCTGGGAGTGG + Intronic
1061539179 9:131268390-131268412 CTCAGCTGGTGAGCAGGTACTGG - Intronic
1061923394 9:133794492-133794514 AGCTGCTGTTGGGCTGGGACGGG - Intronic
1062497614 9:136839078-136839100 CACTGCTGGGGAGCTGGGGCAGG - Exonic
1062554841 9:137109307-137109329 CCCTGCTGGTGGGCAGGGAGAGG + Intergenic
1203621227 Un_KI270749v1:130925-130947 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1186683561 X:11900759-11900781 CACTGGTGGTTGGGTGGTAGTGG + Intergenic
1186749876 X:12610325-12610347 CATTGCTGTTGGGCTGGATCAGG + Intronic
1187772282 X:22713213-22713235 CACTGCTGGAGGGCTGGCAGTGG + Intergenic
1190894035 X:54597909-54597931 CACTGCTGGGGGGATGGTGGAGG + Intergenic
1192657286 X:73004324-73004346 CACTGCTGGTGGGTTGGCGGGGG - Exonic
1192664834 X:73078683-73078705 CACTGCTGGTGGGTTGGCGGGGG + Exonic
1197078990 X:122389188-122389210 CAGCGCTCGTGGGCTGGCACGGG - Intergenic
1202032917 Y:20596941-20596963 CACTGCTGGTGGGTGGGCAGAGG - Intergenic
1202584435 Y:26408782-26408804 CACTGCGGGTGGCCTGGGACGGG - Intergenic