ID: 1070378813

View in Genome Browser
Species Human (GRCh38)
Location 10:75860874-75860896
Sequence CACCTGCCACTTATTGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070378811_1070378813 -6 Left 1070378811 10:75860857-75860879 CCTAGCATCCTGGCTTGCACCTG No data
Right 1070378813 10:75860874-75860896 CACCTGCCACTTATTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070378813 Original CRISPR CACCTGCCACTTATTGAACA TGG Intronic
No off target data available for this crispr